Eremophila neglecta

J.M.Black · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records413

Data sources7

Biological traits17

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Eremophila neglecta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility413 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF413 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila neglecta is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a shrub which branches from ground level and which has lance-shaped leaves and orange-red flowers. It occurs in South Australia and the Northern Territory.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology6

Leaf length30 mm

Leaf width5 mm

Plant height2.5 m

Seed length3 mm

Seed mass27.09 mg

Seed width1 mm

Life cycle & reproduction5

Dispersal typeanimal

Life formshrub

Life spanperennial

Pollination syndromebird

Sex typehermaphrodite

Habitat & environment5

Climatedesert or dry shrubland

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Eremophila neglecta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Chromones1

Polyamines1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(1Z)-2-[6-[[amino-[(Z)-[amino-(4-chloroanilino)methylidene]amino]methylidene]amino]hexyl]-1-[amino-(4-chloroanilino)methylidene]guanidine	present	NPASS
8,19-Dihydroxyserrulat-14-Ene	present	NPASS
8-Hydroxyserrulat-14-En-19-Oic Acid	present	NPASS
AXMCHASUBUDAKX-BORIIKKCSA-N	present	NPASS
Biflorin	present	LOTUS
CID 6956357	present	NPASS
NAPHTHO(1,8-bc)PYRAN-7,8-DIONE, 6,9-DIMETHYL-3-(4-METHYL-3-PENTENYL)-	present	NPASS
VWQWXZAWFPZJDA-CGVGKPPMSA-N	present	NPASS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila neglecta has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411518.1 ↗7 503 bpAustralia

ACGT

TTCAAACCACTTTCCACATTTTTTTCTAATTATTAATATTTTCGCAATATTTAATCAATAAATAAATTAAATAAATATTTTTATACCAAA …

Eremophila neglecta isolate RMF129 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type413 records

Wild obs. + sensor101

Museum / vouchered311

Other1

Origin

Native65

Range

Area of Occupancy AOO1 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 71≤1 km 6>10 km 4

81 georeferenced · 20 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 30≤1 km 59≤10 km 136>10 km 77

302 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence311

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	186
Palmerston, AU	34
Museo Entomologico de Leonlocation not on record	22
Canberra, AU	21
Brisbane, AU	18
Mount Annan, AU	6
Hobart, AU	3
EL PASO, US	1
JBRJlocation not on record	1
Armidale, AU	1

10 institutions · 293 of 311 vouchered records shown · 18 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)