Eremophila mitchellii

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records6 713

Data sources11

Biological traits40

DNA specimens0

eDNA detections0

Sources11 archives

Databases and archives Eremophila mitchellii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 713 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Chemical compositionLOTUS · NPASS58 compounds

Occurrence & distributionGBIF6 713 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila mitchellii, known commonly as false sandalwood and several other names, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a glabrous large shrub or small tree with flaky bark, white or cream-coloured flowers and is capable of root suckering. It is widespread and common in New South Wales and Queensland where it is sometimes a serious pest of grazing land, however essential oils from the plant have been shown to have valuable properties and have been commercially exploited.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology15

Fruit length5.5 mm

Fruit width2.75 mm

Leaf length39.5 mm

Leaf length max60 mm

Leaf length min20 mm

Leaf mass11 mg

Leaf mass per area164 g/m2

Leaf size85 mm²

Leaf width3 mm

Leaf width max5 mm

Leaf width min2.7 mm

Plant height8 m

⚠ sources differ — GIFT: 8 m · AusTraits: 4.7 m · TRY: 3 m

Plant height max10 m

Seed length2.75 mm

Seed mass1.46 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Flowering timennyyynnnyyyn

Life formshrub or tree

Life spanperennial > 20 years

⚠ sources differ — TRY: perennial > 20 years · AusTraits: perennial · GIFT: perennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub · TRY: shrub

Leaf compoundnesssimple

Leaf shapeelliptical

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry6

Leaf n22.4 mg/g

Leaf p0.95 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.51 mm²/mg

Wood density883 mg/cm³

03Chemical composition58 compounds

Compounds documented for Eremophila mitchellii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cadinane sesquiterpenoids12

Eremophilane sesquiterpenoids10

Flavonols6

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids4

Arylnaphthalene and aryltetralin lignans4

Documented compounds58 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Corlumine	present	LOTUS
(+)-Lupanine	present	LOTUS
(-)-Hydrastine	present	LOTUS
(-)-Menthol	present	LOTUS
(1R,2R,5R,8S)-2,6,6,8-tetramethyltricyclo[6.2.1.01,5]undecan-7-one	present	LOTUS
(1S,7S,8S,11R,12R,13S,14S)-8-hydroxy-8,14-dimethyl-2-oxatetracyclo[9.2.1.04,13.07,12]tetradec-4-en-3-one	present	LOTUS
(2E,4E,6E)-5-(acetyloxymethyl)tetradeca-2,4,6-trienoic acid	present	LOTUS
(2R,3R,4aR,5S)-2-hydroxy-4a,5-dimethyl-3-prop-1-en-2-yl-2,3,4,5,6,7-hexahydronaphthalen-1-one	present	LOTUS
(2R,3R,4aR,5S,8aS)-2-hydroxy-4a,5-dimethyl-3-prop-1-en-2-yl-2,3,4,5,6,7,8,8a-octahydronaphthalen-1-one	present	LOTUS
(2R,3R,4aR,5S,8aS)-2-hydroxy-4a,5-dimethyl-3-prop-1-en-2-yl-2,3,4,5,6,8a-hexahydronaphthalen-1-one	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila mitchellii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411422.1 ↗7 518 bpAustralia

ACGT

TTAACCCACTTTCACATTTTTTTTAATTATTAATATTTTCGCAATATTTAATCAATAAATAAATTAAATAAATATTTTTATGTCAAAAAT …

Eremophila mitchellii isolate RMF12 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila mitchellii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 713 records

Wild obs. + sensor4 162

Museum / vouchered828

Other1 723

Origin

Native109

Range

Area of Occupancy AOO13 724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 3 730≤1 km 92≤10 km 133>10 km 36

3 991 georeferenced · 171 without coordinates

Open the mapobservation + sensor4 162

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 146≤1 km 136≤10 km 322>10 km 150

754 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence828

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	317
Canberra, AU	151
Mount Annan, AU	107
Museo Entomologico de Leonlocation not on record	84
Adelaide, AU	58
Armidale, AU	33
Smithfield, AU	17
John T. Waterhouse Herbariumlocation not on record	13
NSW Dept of Planning, Industry and Environmentlocation not on record	10
Kew, GB	9
Palmerston, AU	8
James Cook Townsvillelocation not on record	7
Wollongong, AU	2
EL PASO, US	1
Beijing, CN	1
Parkville, AU	1
Hobart, AU	1

17 institutions · 820 of 828 vouchered records shown · 8 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila mitchellii

At a glance

Sources11 archives

Size & morphology15

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry6

Compound class profile5 classes

Documented compounds58 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 713 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 17 geolocated

Record type6 713 records