Eremophila miniata

C.A.Gardner · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records279

Data sources7

Biological traits20

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Eremophila miniata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility279 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF279 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila miniata, commonly known as kopi poverty bush, or plumridge is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is an erect shrub with many tangled branches, greyish leaves and flowers which vary in colour, ranging from reddish to yellow or cream.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length30.5 mm

Leaf width5.35 mm

Plant height5 m

Plant height max5 m

Plant height min1 m

Life cycle & reproduction4

Flowering timennnnnnyyyyyy

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density598 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Eremophila miniata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Oplopane sesquiterpenoids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-4-methyl-2-[(E)-2-methyl-5-(5-oxo-2H-furan-3-yl)pent-2-enyl]-2H-furan-5-one	present	LOTUS
1-[(1R,3aS,4S,7R,7aS)-4-hydroxy-4-methyl-7-propan-2-yl-1,2,3,3a,5,6,7,7a-octahydroinden-1-yl]ethanone	present	LOTUS
Myoporone	present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila miniata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411458.1 ↗7 327 bpAustralia

ACGT

AAAGGGAGGGTGTGTCTCCTCAGCCTTTCAATGTCTACTGCTGTCACAAGGGATTTCTTTTTTAAGACTACTATAGGGGGGGGGAGGTGC …

Eremophila miniata isolate MJB2388 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type279 records

Wild obs. + sensor55

Museum / vouchered224

Origin

Native14

Range

Area of Occupancy AOO804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 28≤1 km 4≤10 km 4>10 km 9

45 georeferenced · 10 without coordinates

Open the mapobservation + sensor55

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 34≤1 km 26≤10 km 113>10 km 13

186 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence224

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	113
Adelaide, AU	45
Canberra, AU	19
Mount Annan, AU	10
BGPAlocation not on record	8
Museo Entomologico de Leonlocation not on record	6
Palmerston, AU	6
Kew, GB	5
Brisbane, AU	4
Parkville, AU	3
EL PASO, US	2
Taipei, TW	1
MAlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1

14 institutions · 224 of 224 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)