Eremophila margarethae

S.Moore · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records253

Data sources5

Biological traits22

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila margarethae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility253 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF253 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila margarethae, commonly known as sandbank poverty bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a low, spreading shrub with grey leaves, flowers a shade of pink or purple, common in central areas of Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length27 mm

Leaf width3.5 mm

Plant height0.9 m

Plant height max1.2 m

Plant height min0.3 m

Seed length2.5 mm

Seed width1 mm

Life cycle & reproduction4

Flowering timennnyyyyyyynn

Life formsubshrub or shrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila margarethae has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411485.1 ↗6 942 bpAustralia

ACGT

TTGAAATAAGCGAGCCAATCCGATTGGCATTGGCTCTAGCGGTGTGTCGTGCTGCGAGTGCCCCAAGGGTGTGCGCGGCAAGGCTATCCG …

Eremophila margarethae isolate MJB2425 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type253 records

Wild obs. + sensor52

Museum / vouchered201

Origin

Native7

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 36≤10 km 5>10 km 1

42 georeferenced · 10 without coordinates

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 21≤1 km 29≤10 km 110>10 km 14

174 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence201

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	99
Adelaide, AU	57
Canberra, AU	19
Museo Entomologico de Leonlocation not on record	8
Mount Annan, AU	6
Kew, GB	3
Palmerston, AU	3
EL PASO, US	1
John T. Waterhouse Herbariumlocation not on record	1
Claremont, US	1
Parkville, AU	1
MAlocation not on record	1
BGPAlocation not on record	1

13 institutions · 201 of 201 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)