Eremophila malacoides

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records80

Data sources5

Biological traits17

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila malacoides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF80 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila malacoides, commonly known as frontage poverty bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a shrub with grey-green foliage, densely hairy leaves, and usually lilac to purple flowers but a yellow flowered form also occurs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length10 mm

Leaf width4.25 mm

Plant height1 m

Plant height max1.5 m

Plant height min0.3 m

Life cycle & reproduction3

Flowering timennnyyyyyyyyn

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila malacoides has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411484.1 ↗7 354 bpAustralia

ACGT

TATATTTGAATTATTCACCCATTTTTGAGGCCACATACAAATTTTCAAGCAAAATAAATAACAAATACCACAAAAAAGGGTGGGTGTGAC …

Eremophila malacoides isolate MJB2424 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type80 records

Wild obs. + sensor6

Museum / vouchered74

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2>10 km 1

3 georeferenced · 3 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 14≤1 km 13≤10 km 26>10 km 3

56 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	40
Adelaide, AU	11
Canberra, AU	8
Parkville, AU	3
Museo Entomologico de Leonlocation not on record	3
BGPAlocation not on record	3
Kew, GB	2
John T. Waterhouse Herbariumlocation not on record	2
Palmerston, AU	1

9 institutions · 73 of 74 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)