Eremophila maitlandii

F.Muell. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records154

Data sources7

Biological traits20

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Eremophila maitlandii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility154 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF154 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila maitlandii, commonly known as Shark Bay poverty bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a silvery-grey shrub with linear leaves and lilac-coloured to light purple flowers and is common in coastal areas between Shark Bay and Carnarvon.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length44 mm

Leaf width4.25 mm

Plant height3 m

Plant height max3 m

Plant height min1 m

Seed length4.5 mm

Seed width1 mm

Life cycle & reproduction4

Flowering timennnnyyyyyyyy

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila maitlandii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411465.1 ↗6 066 bpAustralia

ACGT

ATGCGTTCGACGCTTCGTGCGAACGACTCCGTGCCCGCTGTGATAGAGTCCTTGTGGCTCGATTCATGCGGGTGTCGGCGTCGGTAAGGA …

Eremophila maitlandii isolate MJB2397 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila maitlandii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type154 records

Wild obs. + sensor27

Museum / vouchered127

Origin

Native5

Range

Area of Occupancy AOO484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 6≤1 km 10≤10 km 6>10 km 1

23 georeferenced · 4 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 19≤1 km 20≤10 km 60>10 km 11

110 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence127

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	67
Adelaide, AU	28
Canberra, AU	11
Museo Entomologico de Leonlocation not on record	8
Mount Annan, AU	5
Brisbane, AU	2
Claremont, US	1
Parkville, AU	1
Hobart, AU	1
Kew, GB	1
BGPAlocation not on record	1
Palmerston, AU	1

12 institutions · 127 of 127 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)