Eremophila maculata

(Ker Gawl.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records1 119

Data sources9

Biological traits39

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Eremophila maculata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 119 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 119 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila maculata, also known as spotted emu bush or spotted fuchsia-bush, is a plant in the figwort family Scrophulariaceae, and is endemic to Australia. It is the most widespread of its genus in nature and probably the most frequently cultivated Eremophila. It is a spreading, often densely branched shrub with variable leaf shape and flower colour, but the other features of the flowers such as the size and shape of the parts are consistent. The inside of the flower is often, but not always, spotted.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology18

Fruit length14.5 mm

Fruit width13.5 mm

Leaf length37 mm

Leaf length max40 mm

Leaf length min10 mm

Leaf size73 mm²

Leaf width6 mm

Leaf width max14 mm

Leaf width min2 mm

Petiole length0.6 cm

Plant height2 m

⚠ sources differ — GIFT: 2 m · AusTraits: 2.25 m · TRY: 1.5 m

Plant height max3 m

Plant height min0.2 m

Seed length6 mm

Seed mass0.269 mg

⚠ sources differ — TRY: 0.269 mg · AusTraits: 28.81 mg · GIFT: 231 mg

Seed mass max352 mg

Seed mass min109 mg

Seed width1.7 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

⚠ sources differ — AusTraits: zoochory · GIFT: unspecialized

Flowering timeyyyyynnnnnny

Life formshrub

Life spanperennial > 20 years

⚠ sources differ — TRY: perennial > 20 years · AusTraits: perennial · GIFT: perennial

Pollination syndromebird

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.71 mm²/mg

03Chemical composition1 compounds

Compounds documented for Eremophila maculata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Iridoids monoterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Catalpol		present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila maculata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411393.1 ↗6 815 bpAustralia

ACGT

GGCTTGATCTCAAAGCTACTGGATGTTAGGCCGCGGTGTCCCGAACGTGCGGTCCCGCTCCTATTGGGACGTGCATGGCAAGGTTTACCG …

Eremophila maculata subsp. filifolia isolate RMF166 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL6★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila maculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 119 records

Wild obs. + sensor836

Museum / vouchered233

Cultivated / captive3

Other47

Origin

Native125

Introduced1

Range

Area of Occupancy AOO3 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 543≤1 km 45≤10 km 91>10 km 37

716 georeferenced · 120 without coordinates

Open the mapobservation + sensor836

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 59≤1 km 43≤10 km 53>10 km 9

164 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence233

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	40
Adelaide, AU	35
Armidale, AU	29
Museo Entomologico de Leonlocation not on record	22
John T. Waterhouse Herbariumlocation not on record	10
Hobart, AU	9
Smithfield, AU	8
Canberra, AU	7
ASUlocation not on record	5
NSW Dept of Planning, Industry and Environmentlocation not on record	5
Palmerston, AU	4
Canadian Department of Agriculturelocation not on record	3
Stockholm, SE	3
La Trobe Universitylocation not on record	3
James Cook Townsvillelocation not on record	3
Kew, GB	3
Moscow State Universitylocation not on record	2
Parkville, AU	2
Brisbane, AU	2
Bronx, US	2
Miami, US	2
Rotorua, NZ	1
MAlocation not on record	1
Beijing, CN	1
AUAlocation not on record	1
PRClocation not on record	1
Wollongong, AU	1
EL PASO, US	1
Phoenix, US	1
Riverside, US	1
BGPAlocation not on record	1
Flagstaff, US	1

32 institutions · 210 of 233 vouchered records shown · 23 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila maculata

At a glance

Sources9 archives

Size & morphology18

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry3

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 119 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 32 geolocated

Cultivated / Captivenot free-living

Record type1 119 records