Eremophila macgillivrayi

J.M.Black · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records103

Data sources5

Biological traits16

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila macgillivrayi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility103 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF103 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila macgillivrayi , also known as dog bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a shrub with grey foliage, clustered leaves and red, sometimes yellow flowers. The leaf base is twisted so that the leaf surface is usually close to vertical. It only occurs near the border between South Australia and Queensland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology5

Fruit length14 mm

Fruit width5.5 mm

Leaf length42 mm

Leaf width4.75 mm

Plant height3 m

Life cycle & reproduction5

Dispersal typeanimal

Life formshrub

Life spanperennial

Pollination syndromebird

Sex typehermaphrodite

Habitat & environment5

Climatedesert or dry shrubland

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila macgillivrayi has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN486175.1 ↗7 501 bpAustralia

ACGT

TTCAACCCACTTTCCACATTTTTTGCTAATTATTAATATTTTCGCATATATTTAATCAATAAATAAATTAAATAATTTTTTTTCGGAGCA …

Eremophila macgillivrayi isolate RMF183 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type103 records

Wild obs. + sensor18

Museum / vouchered85

Origin

Native17

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 13≤10 km 2

15 georeferenced · 3 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 11≤1 km 14≤10 km 35>10 km 21

81 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence85

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	44
Brisbane, AU	19
Canberra, AU	12
Museo Entomologico de Leonlocation not on record	3
Mount Annan, AU	2
Parkville, AU	1
Armidale, AU	1
Palmerston, AU	1

8 institutions · 83 of 85 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)