Eremophila lucida

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records54

Data sources5

Biological traits16

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila lucida's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources16 traits

Occurrence & distributionGBIF54 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila lucida, commonly known as shining poverty bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is an erect shrub with sticky, shiny leaves and branches and with flowers that are either red with darker red blotches inside or cream-coloured without spots or blotches.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology4

Leaf length69.5 mm

Leaf width11.25 mm

Plant height2.65 m

Seed mass14.72 mg

Life cycle & reproduction3

Flowering timennnnnnnnnynn

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila lucida has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411585.1 ↗7 494 bpAustralia

ACGT

TATTAACCACTTTCCACATTTTTTTCTAATTACTTGTGTTTTCGCAATATTTAATCAATAAATAATTAAATAAATATTTTTCGGAGCAAA …

Eremophila lucida isolate RMF292 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type54 records

Wild obs. + sensor4

Museum / vouchered49

Cultivated / captive1

Origin

Native2

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 3

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤1 km 1≤10 km 46

47 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence49

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	18
Museo Entomologico de Leonlocation not on record	10
Adelaide, AU	9
Canberra, AU	7
Kew, GB	2
Mount Annan, AU	1
Palmerston, AU	1
BGPAlocation not on record	1

8 institutions · 49 of 49 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)