Eremophila longifolia

(R.Br.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records9 123

Data sources10

Biological traits48

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Eremophila longifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 123 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources48 traits

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF9 123 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Eremophila graciliflora, commonly known as slender-flowered eremophila, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a shrub with linear to lance-shaped leaves and red flowers known only from the type specimen collected by Augustus Oldfield and held at the State Botanical Collection at Royal Botanic Gardens in Melbourne, so that a living example has not been recorded for more than 150 years.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology22

Fruit length8.5 mm

Fruit width8.5 mm

Leaf length95 mm

Leaf length max200 mm

Leaf length min30 mm

Leaf mass62 mg

Leaf mass per area232 g/m2

Leaf size146 mm²

⚠ sources differ — TRY: 146 mm² · AusTraits: 264 mm²

Leaf width4 mm

Leaf width max14 mm

Leaf width min3 mm

Plant height3.5 m

Plant height max8 m

Plant height min1 m

Seed length3.5 mm

Seed mass1.26 mg

⚠ sources differ — TRY: 1.26 mg · AusTraits: 48.13 mg · GIFT: 97.92 mg

Seed mass max166 mg

Seed mass min18.11 mg

Seed volume100 mm³

Seed volume max100 mm³

Seed volume min100 mm³

Seed width1.1 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyyyyyyyyyyyy

Life formshrub or tree

Life spanperennial > 20 years

⚠ sources differ — TRY: perennial > 20 years · AusTraits: perennial · GIFT: perennial

Pollination syndromebird

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapelanceolate linear

Woodinesswoody

Physiology & chemistry7

Leaf dry-matter content (LDMC)437 mg/g

Leaf n14.62 mg/g

Leaf p1 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)4.02 mm²/mg

Wood density703 mg/cm³

03Chemical composition11 compounds

Compounds documented for Eremophila longifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Cinnamic acids and derivatives2

Chalcones1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(,6E)-3,7-Dimethyl-2,6-octadienyl cinnamate	present	NPASS
[(2Z)-3,7-dimethylocta-2,6-dienyl] (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate	present	LOTUS
[(2Z)-3,7-dimethylocta-2,6-dienyl] (E)-3-(4-hydroxyphenyl)prop-2-enoate	present	LOTUS
DOAKLVKFURWEDJ-RWDRXURGSA-N	present	NPASS
Fluconazole	present	NPASS
LCTORFDMHNKUSG-XTTLPDOESA-N	present	NPASS
OOQZCQKEFKRXLR-UECATJJXSA-N	present	NPASS
Tamoxifen	present	NPASS
XLRIJUDLSZEHFF-NIFVBKMISA-N	present	NPASS
ZQBSQGXPHDABSV-HLCISAKDSA-N	present	NPASS

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila longifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411563.1 ↗7 473 bpAustralia

ACGT

TTCAACCCACTTCCACATTTTTTTCTAATTATTAATATTTTCGCAATATTTAATCAATAAATAAATTAAATAAATTATTTTCGAAACAAA …

Eremophila longifolia isolate RMF241 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★ITS4

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Eremophila longifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type9 123 records

Wild obs. + sensor6 009

Museum / vouchered2 961

Cultivated / captive5

Other148

Origin

Native2 332

Range

Area of Occupancy AOO24 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 3 023≤1 km 1 368≤10 km 526>10 km 93

5 010 georeferenced · 999 without coordinates

Open the mapobservation + sensor6 009

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 541≤1 km 509≤10 km 1 296>10 km 416

2 762 georeferenced · 199 without coordinates

Open the institutions mapphysical evidence2 961

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 2 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	891
Brisbane, AU	376
Museo Entomologico de Leonlocation not on record	342
Canberra, AU	316
Palmerston, AU	271
Kensington, AU	245
Mount Annan, AU	210
Armidale, AU	42
John T. Waterhouse Herbariumlocation not on record	28
NSW Dept of Planning, Industry and Environmentlocation not on record	27
Hobart, AU	21
Smithfield, AU	15
Kew, GB	12
Parkville, AU	7
Claremont, US	6
James Cook Townsvillelocation not on record	4
Auckland, NZ	3
Christchurch, NZ	3
University of Stellenboschlocation not on record	2
Stockholm, SE	2
IPA/SPlocation not on record	1
MeiseBGlocation not on record	1
Guangzhou, CN	1
Miami, US	1
GB	1
Beijing, CN	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
PRClocation not on record	1
MAlocation not on record	1
Taipei, TW	1
BGPAlocation not on record	1
Lubbock, US	1

32 institutions · 2 835 of 2 961 vouchered records shown · 126 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila longifolia

At a glance

Sources10 archives

Size & morphology22

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry7

Compound class profile2 classes

Documented compounds11 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type9 123 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions21 of 32 geolocated

Cultivated / Captivenot free-living

Record type9 123 records