Eremophila linsmithii

R.J.F.Hend. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records117

Data sources5

Biological traits16

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila linsmithii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility117 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF117 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila linsmithii is a plant in the figwort family, Scrophulariaceae and is endemic to Queensland. It is an erect shrub, branching from the base with narrow, sticky leaves, and white to pale lilac-coloured flowers and is found only in the south west corner of the state.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology5

Leaf length40 mm

Leaf width2 mm

Plant height2.5 m

Seed length2.25 mm

Seed width0.8 mm

Life cycle & reproduction5

Dispersal typeanimal

Life formsubshrub or shrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Habitat & environment5

Climateseasonally dry tropical

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila linsmithii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411511.1 ↗7 499 bpAustralia

ACGT

TTCTAAAGATTTCCAATTTTTCCAAAATTATTGTATTTTGCAATATTTAATTAATAAATAAATTAAATAAAATTTTTTGGATCAAAAATT …

Eremophila linsmithii isolate RMF118 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type117 records

Wild obs. + sensor14

Museum / vouchered102

Other1

Origin

Native1

Introduced1

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 7≤1 km 1≤10 km 1>10 km 1

10 georeferenced · 4 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 16≤1 km 16≤10 km 48>10 km 14

94 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence102

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	47
Adelaide, AU	28
Canberra, AU	9
Kew, GB	5
Museo Entomologico de Leonlocation not on record	5
Palmerston, AU	4
Mount Annan, AU	1
IPA/SPlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1

9 institutions · 101 of 102 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)