Eremophila linearis

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records132

Data sources6

Biological traits22

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eremophila linearis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility132 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF132 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila linearis, commonly known as harlequin fuchsia bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a shrub with long leaves, sticky, shiny leaves and branches and bright red flowers

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length19.5 mm

Leaf width1.45 mm

Plant height3 m

Plant height max3 m

Plant height min1 m

Seed length4.75 mm

Seed width1 mm

Life cycle & reproduction4

Flowering timennnnyyyyynnn

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila linearis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411481.1 ↗7 534 bpAustralia

ACGT

TTCAAACCACTTCCCACTTTTTTTCTAATTATTAATATTTTCGCAATATTTTATCAATAAATAAATTAAATAAATATTTTTCGGGCAAAT …

Eremophila linearis isolate MJB2420 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type132 records

Wild obs. + sensor6

Museum / vouchered126

Origin

Native4

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 14≤1 km 22≤10 km 61>10 km 15

112 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	62
Adelaide, AU	32
Canberra, AU	14
Museo Entomologico de Leonlocation not on record	5
Mount Annan, AU	4
Parkville, AU	3
BGPAlocation not on record	2
Kew, GB	1
John T. Waterhouse Herbariumlocation not on record	1
Palmerston, AU	1

10 institutions · 125 of 126 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)