Eremophila lehmanniana

(Sond. ex Lehm.) Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records284

Data sources5

Biological traits18

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila lehmanniana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility284 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF284 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila lehmanniana is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is an erect shrub, usually with short, wide, serrated leaves and white to lilac-coloured flowers. It occurs in the south west of Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length7 mm

Leaf width3.5 mm

Plant height1.5 m

Plant height max2.5 m

Plant height min0.3 m

Life cycle & reproduction4

Flowering timennnnnnyyyyyn

Life formsubshrub or shrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila lehmanniana has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411539.1 ↗7 505 bpAustralia

ACGT

TTCAACCCACTTTCCACATTTTTTCTAATTATTAATATTTTCGCAATATTTTATCAATAAATAAATTAAATAAATATTTTTCGGAGTAAA …

Eremophila lehmanniana isolate RMF185 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type284 records

Wild obs. + sensor39

Museum / vouchered245

Origin

Native13

Range

Area of Occupancy AOO732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 20≤1 km 9≤10 km 2

31 georeferenced · 8 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 36≤1 km 43≤10 km 105>10 km 27

211 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence245

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	118
Adelaide, AU	47
Museo Entomologico de Leonlocation not on record	36
Canberra, AU	15
Mount Annan, AU	13
Brisbane, AU	8
Parkville, AU	3
Hobart, AU	2
Kew, GB	2
Stockholm, SE	1

10 institutions · 245 of 245 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)