Eremophila latrobei

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records2 417

Data sources8

Biological traits40

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Eremophila latrobei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 417 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Chemical compositionNPASS16 compounds

Occurrence & distributionGBIF2 417 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Eremophila latrobei, commonly known as crimson turkey bush, native fuchsia, Latrobe's emu bush, grey fuchsia bush, warty fuchsia bush and Georgina poison bush is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is an erect, highly branched shrub with usually linear leaves and red to purple-red flowers and which occurs in all mainland states, including the Northern Territory but excluding Victoria.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology19

Fruit length7.75 mm

Fruit width4.5 mm

Leaf length19.97 mm

Leaf length max90 mm

Leaf length min10 mm

Leaf mass3.3 mg

Leaf mass per area179 g/m2

Leaf size60 mm²

Leaf width2.1 mm

Leaf width max5 mm

Leaf width min1 mm

Plant height2.5 m

⚠ sources differ — AusTraits: 2.5 m · TRY: 1.75 m

Plant height max3 m

Plant height min0.8 m

Seed length3.25 mm

Seed mass32.62 mg

⚠ sources differ — TRY: 32.62 mg · AusTraits: 1.7 mg · GIFT: 32.62 mg

Seed mass max40.84 mg

Seed mass min24.4 mg

Seed width1 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeself

⚠ sources differ — AusTraits: barochory · GIFT: unspecialized

Flowering timennnnnyyyyyyy

Life formshrub

Life spanperennial

Pollination syndromebird

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear oblanceolate terete

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.06 mm²/mg

03Chemical composition16 compounds

Compounds documented for Eremophila latrobei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Ergostane steroids5

Cholestane steroids $ Ergostane steroids4

Pyridine alkaloids1

Pseudopterane diterpenoids1

Imidazole alkaloids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,5R,8R,9R,12R,13R,16S)-8-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-9,13-dimethyl-18,19-dioxapentacyclo[10.5.2.01,13.04,12.05,9]nonadec-3-ene-2,16-diol	present	NPASS
(1S,4S,6S,9R,10R,13S,14S,17S)-9-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-10,14-dimethyl-5,19,20-trioxahexacyclo[11.5.2.01,14.04,6.04,13.06,10]icos-2-en-17-ol	present	NPASS
(22E,24R)-3beta,5alpha-dihydroxyergosta-7,22-dien-6-one	present	NPASS
(3beta,5alpha,22E)-5,9-Epidioxy-3-hydroxyergosta-7,22-dien-6-one	present	NPASS
(3S,5R,9S,10R,13R,14R,17R)-17-[(2R,5S)-5,6-dimethylheptan-2-yl]-3,5-dihydroxy-10,13-dimethyl-2,3,4,9,11,12,14,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one	present	NPASS
1,2-Dihydroxymintlactone	present	NPASS
[(3S,5R,6R,9S,10R,13R,14R,17R)-17-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-3,5-dihydroxy-10,13-dimethyl-1,2,3,4,6,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-6-yl] acetate	present	NPASS
Ergosta-7,22-Dien-3Beta,5Alpha,9Alpha-Trihydroxy-6-One	present	NPASS
Ergosterol	present	NPASS
Ergosterol Peroxide	present	NPASS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila latrobei has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP021874.1 ↗7 461 bp

ACGT

CCACTTTTTTTTCTAATTATTAGTATTTTCGCAATATTTTATTAATATATAAATTAAATAAATATTTTTTCGGAACAAAAATTGTATTTT …

Eremophila latrobei subsp. glabra isolate BMR01806 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL8★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Eremophila latrobei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 417 records

Wild obs. + sensor2 035

Museum / vouchered336

Other46

Origin

Native281

Range

Area of Occupancy AOO6 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 438≤1 km 105≤10 km 96>10 km 58

1 697 georeferenced · 338 without coordinates

Open the mapobservation + sensor2 035

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 83≤1 km 37≤10 km 114>10 km 36

270 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence336

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	64
Kensington, AU	60
Palmerston, AU	44
Mount Annan, AU	31
Adelaide, AU	26
Kew, GB	19
John T. Waterhouse Herbariumlocation not on record	16
Smithfield, AU	12
Brisbane, AU	9
Canberra, AU	7
James Cook Townsvillelocation not on record	5
Hobart, AU	4
Beijing, CN	3
Parkville, AU	3
EL PASO, US	2
Wellington, NZ	1
IPA/SPlocation not on record	1
Auckland, NZ	1
Armidale, AU	1
STUlocation not on record	1

20 institutions · 310 of 336 vouchered records shown · 26 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila latrobei

At a glance

Sources8 archives

Size & morphology19

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry3

Compound class profile5 classes

Documented compounds16 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 417 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 20 geolocated

Record type2 417 records