Eremophila laanii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records74

Data sources5

Biological traits20

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila laanii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF74 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila laanii is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a shrub or small tree with many tangled branches and flowers in a number of colour forms. It seems to be mostly restricted to the upper reaches of the beds and nearby flats of two rivers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length33 mm

Leaf width4.5 mm

Plant height2.4 m

Plant height max2.4 m

Plant height min0.9 m

Seed length3.75 mm

Seed width1.15 mm

Life cycle & reproduction4

Flowering timennnnnyyyyyyy

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila laanii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411507.1 ↗7 253 bpAustralia

ACGT

TTCACAACATTTTCCATATTTTTTATAATTATTAATTTTCTTGCAATATTTAATTAATAAATAAATTAAATAAATAATTTTCGGAGCAAA …

Eremophila laanii isolate RMF109 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type74 records

Wild obs. + sensor7

Museum / vouchered67

Origin

Native2

Range

Area of Occupancy AOO164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 3 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 6≤1 km 8≤10 km 31>10 km 11

56 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	29
Adelaide, AU	15
Canberra, AU	7
Museo Entomologico de Leonlocation not on record	4
Parkville, AU	2
Mount Annan, AU	2
Brisbane, AU	2
Palmerston, AU	2
Kew, GB	1
Hobart, AU	1
BGPAlocation not on record	1

11 institutions · 66 of 67 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)