Eremophila koobabbiensis

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records9

Data sources4

Biological traits8

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Eremophila koobabbiensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility9 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF9 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila koobabbiensis, commonly known as Koobabbie eremophila, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is an erect shrub with hairy branches, pale green leaves and lilac to pale mauve flowers. It is only known from a single farm where there were 96 mature plants in 2010, but specimens grown from cuttings survive in Victoria (Australia) and South Australia, as well as in Kings Park, Perth.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Life cycle & reproduction2

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Growth formshrub

Woodinesswoody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila koobabbiensis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411432.1 ↗7 463 bpAustralia

ACGT

TTCAACCCACTTTCACATTTTTTTAATTATTGCTATTTTCGCAATATTTAATCAATAAATAAATTAAATAAATATTTTTGGGCAAAAATT …

Eremophila koobabbiensis isolate MJB2353 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type9 records

Museum / vouchered5

Cultivated / captive4

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence5

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced

Open the mapnot free-living4

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	2
Museo Entomologico de Leonlocation not on record	1
Kew, GB	1
Canberra, AU	1

4 institutions · 5 of 5 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)