Eremophila ionantha

Diels · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records380

Data sources6

Biological traits26

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eremophila ionantha's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility380 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF380 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila ionantha is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a shrub with many sticky branches, narrow, light green leaves and blue, purple or violet flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Leaf length19.5 mm

Leaf width1.05 mm

Plant height2 m

Plant height max2 m

Plant height min0.3 m

Seed length1.6 mm

Seed mass8.69 mg

Seed mass max8.69 mg

Seed mass min8.69 mg

Seed width0.6 mm

Life cycle & reproduction6

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formshrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Eremophila ionantha across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Iridoids monoterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Verminoside		present	LOTUS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila ionantha has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411501.1 ↗6 853 bpAustralia

ACGT

GGGGGGAGGGCTGAGAGGGGAGGGCGCGAGGTGCTGGGCGGCCTAGTGCTCGCCCAGCATGCCCAGCAAGGCCCATGCTCAAGCATCCCC …

Eremophila ionantha isolate MJB2461 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type380 records

Wild obs. + sensor123

Museum / vouchered256

Cultivated / captive1

Origin

Native5

Range

Area of Occupancy AOO1 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 100≤1 km 4≤10 km 7>10 km 3

114 georeferenced · 9 without coordinates

Open the mapobservation + sensor123

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 61≤1 km 47≤10 km 102>10 km 18

228 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence256

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	134
Adelaide, AU	53
Canberra, AU	25
Museo Entomologico de Leonlocation not on record	22
Mount Annan, AU	6
Brisbane, AU	5
BGPAlocation not on record	4
MAlocation not on record	1
Claremont, US	1
Kew, GB	1
IPA/SPlocation not on record	1
Parkville, AU	1
John T. Waterhouse Herbariumlocation not on record	1
Palmerston, AU	1

14 institutions · 256 of 256 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)