Eremophila interstans

(S.Moore) Diels · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records44

Data sources6

Biological traits22

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eremophila interstans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility44 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF44 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila interstans is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a shrub or small tree found in Western Australia and South Australia and has narrow leaves with a hooked end, and white or cream-coloured flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length12.75 mm

Leaf width0.85 mm

Plant height6 m

Plant height max7 m

Plant height min0.9 m

Life cycle & reproduction6

Dispersal typeanimal

Flowering timeyynnnnnyyyyy

Life formshrub or tree

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density810 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila interstans has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411395.1 ↗7 446 bpAustralia

ACGT

ATATTTCCAATATTTAATCAATAAATAAATTAAATAAATATTTTTCGGAGCAAAAATTATTTTTTCAACTACATTTGAATTATTCACCCA …

Eremophila interstans subsp. interstans isolate RMF199 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type44 records

Wild obs. + sensor21

Museum / vouchered23

Origin

Native2

Range

Area of Occupancy AOO164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 21

21 georeferenced

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 6≤10 km 8>10 km 4

18 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	12
Mount Annan, AU	2
Kew, GB	2
Brisbane, AU	2
Adelaide, AU	2
Parkville, AU	1
Palmerston, AU	1
BGPAlocation not on record	1

8 institutions · 23 of 23 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)