Eremophila hygrophana

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records72

Data sources5

Biological traits22

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila hygrophana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility72 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF72 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila hygrophana is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is an erect, compact shrub with crowded, grey leaves and violet to purple flowers and is native to South Australia and Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length18.5 mm

Leaf width3.75 mm

Plant height0.75 m

Plant height max0.75 m

Plant height min0.25 m

Seed length2.2 mm

Seed width1 mm

Life cycle & reproduction5

Dispersal typeanimal

Flowering timennnnnnnyyyyy

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila hygrophana has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411497.1 ↗7 507 bpAustralia

ACGT

TTCAAACCACTTTTCCCATTTTTTTCTAATTATTACTATTTTCGCAATATTTAAACAATAAATAAATTAAATAAATATTTTTCGGGGCAA …

Eremophila hygrophana isolate MJB2454 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type72 records

Wild obs. + sensor14

Museum / vouchered58

Origin

Native9

Range

Area of Occupancy AOO232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 11

11 georeferenced · 3 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 25≤1 km 7≤10 km 16>10 km 3

51 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	30
Adelaide, AU	9
Palmerston, AU	5
Canberra, AU	4
Mount Annan, AU	3
BGPAlocation not on record	2
Brisbane, AU	1
Museo Entomologico de Leonlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
Parkville, AU	1
Turlock, US	1

11 institutions · 58 of 58 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)