Eremophila hillii

E.A.Shaw · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records51

Data sources5

Biological traits22

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila hillii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF51 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila hillii, commonly known as Hill's emu bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to the Nullarbor Plain in Australia. It is a dense shrub with many tangled branches, densely hairy stems, leaves and sepals and red or yellow petals.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length13.25 mm

Leaf width7.25 mm

Plant height0.8 m

Plant height max1 m

Plant height min0.3 m

Seed length3.5 mm

Seed width1.15 mm

Life cycle & reproduction6

Dispersal typeanimal

Flowering timennnnnnyyynnn

Life formshrub

Life spanperennial

Pollination syndromebird

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila hillii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN486174.1 ↗7 270 bpAustralia

ACGT

GGGGGGGAGGTGCTTGAGAGGGTGATGGGCGCTGAGGGTGCTGGGCGGCCTAGTGCTCGCCTAGCACTCCCAGCAAGGCCCATGCCCAAG …

Eremophila hillii isolate BB0705 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type51 records

Wild obs. + sensor4

Museum / vouchered47

Origin

Native6

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 5≤1 km 12≤10 km 21>10 km 6

44 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	30
Museo Entomologico de Leonlocation not on record	6
Kensington, AU	6
Canberra, AU	4
Mount Annan, AU	1

5 institutions · 47 of 47 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)