Eremophila granitica

S.Moore · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records361

Data sources5

Biological traits19

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila granitica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility361 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Occurrence & distributionGBIF361 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila granitica, commonly known as granite poverty bush and thin-leaved poverty bush is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is an erect, open shrub with sticky, narrow leaves and with lilac-coloured flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length12.75 mm

Leaf width5 mm

Plant height2 m

Plant height max2 m

Plant height min0.3 m

Life cycle & reproduction4

Flowering timennyyyyyyyynn

Life formsubshrub or shrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila granitica has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411500.1 ↗6 483 bpAustralia

ACGT

GGGCATGTTGGATCCCTGCTCGGGCAGCGACGACATTCCATTCAAGCCTCTTCAGTTTTGAGGGCACAAGTGCTTGTTTAGCCTTGGCCG …

Eremophila granitica isolate MJB2459 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type361 records

Wild obs. + sensor80

Museum / vouchered281

Origin

Native21

Range

Area of Occupancy AOO1 060 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 74≤1 km 1≤10 km 5

80 georeferenced

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 59≤1 km 50≤10 km 121>10 km 25

255 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence281

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	152
Adelaide, AU	45
Canberra, AU	30
Museo Entomologico de Leonlocation not on record	21
Mount Annan, AU	20
Brisbane, AU	5
Kew, GB	2
Joondalup, AU	2
Palmerston, AU	2
Parkville, AU	1
Claremont, US	1

11 institutions · 281 of 281 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)