Eremophila goodwinii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records221

Data sources7

Biological traits33

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Eremophila goodwinii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility221 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF221 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila goodwinii, commonly known purple fuchsia bush and Goodwin's emu bush is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a small, spreading or erect shrub with most parts sticky due to the presence of resin, tapering leaves and pale lilac to mauve flowers. It occurs in New South Wales, the Northern Territory and Queensland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology14

Fruit length9.5 mm

Fruit width9 mm

Leaf length43 mm

Leaf length max70 mm

Leaf length min20 mm

Leaf width3 mm

Leaf width max6.5 mm

Leaf width min2 mm

Plant height1 m

Plant height max1.5 m

Plant height min0.6 m

Seed length2.5 mm

Seed mass153 mg

Seed width1 mm

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennnnnnnnyyyy

Life formshrub

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila goodwinii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411394.1 ↗7 520 bpAustralia

ACGT

TTATAATATATTTACACAATTTTTTACTAATTATTAGTATTTTCGCAATATTTAATCAATAAATTAATTAAATAATATTTTTTGGATCAA …

Eremophila goodwinii subsp. ecapitata isolate RMF178 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila goodwinii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type221 records

Wild obs. + sensor128

Museum / vouchered91

Cultivated / captive2

Origin

Native27

Range

Area of Occupancy AOO596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 61≤1 km 3≤10 km 10>10 km 2

76 georeferenced · 52 without coordinates

Open the mapobservation + sensor128

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 9≤1 km 10≤10 km 41>10 km 10

70 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence91

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	26
Adelaide, AU	19
Museo Entomologico de Leonlocation not on record	18
Armidale, AU	6
Palmerston, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Kew, GB	4
Canberra, AU	4
EL PASO, US	1
Hobart, AU	1
Smithfield, AU	1

11 institutions · 89 of 91 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)