Eremophila glabra

(R.Br.) Ostenf. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records5 039

Data sources8

Biological traits45

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Eremophila glabra's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 039 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources45 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF5 039 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

E. glabra 'Murchison Magic' in Maranoa Gardens E. glabra subsp. carnosa from the coast near Geraldton E. glabra subsp. South Coast - an undescribed subspecies Eremophila glabra 'Murchison River orange' Eremophila glabra subsp. chlorella Eremophila glabra, commonly known as tar bush, is a plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is sometimes a low, ground-hugging and sometimes an erect shrub. The leaves are variable in size and shape and there is a range of flower colours. In spite of its scientific name, not all forms of the plant are glabrous but most have many small, raised glands on the stems, flowers and leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology19

Fruit length7 mm

Fruit width6 mm

Leaf length37 mm

Leaf length max60 mm

Leaf length min7 mm

Leaf mass25 mg

Leaf mass per area167 g/m2

Leaf size71.5 mm²

⚠ sources differ — TRY: 71.5 mm² · AusTraits: 125 mm²

Leaf width5 mm

Leaf width max18 mm

Leaf width min1 mm

Plant height1.82 m

⚠ sources differ — AusTraits: 1.82 m · TRY: 1.97 m

Plant height max4 m

Plant height min0.1 m

Seed length3 mm

Seed mass1.93 mg

⚠ sources differ — TRY: 1.93 mg · AusTraits: 54.9 mg · GIFT: 83.02 mg

Seed mass max83.02 mg

Seed mass min83.02 mg

Seed width1 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyynnnyyyyyyy

Life formsubshrub or shrub

Life spanperennial

Pollination syndromebird

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapelanceolate oblanceolate

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry7

Leaf c471 mg/g

Leaf dry-matter content (LDMC)472 mg/g

Leaf n17.21 mg/g

Leaf p1.27 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.75 mm²/mg

03Chemical composition3 compounds

Compounds documented for Eremophila glabra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Serrulatane and Biflorane diterpenoids2

Cinnamic acids and derivatives $ Phenylethanoids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(5R,8S)-4-acetyloxy-5-(acetyloxymethyl)-8-[(2S)-6-methylhept-5-en-2-yl]-5,6,7,8-tetrahydronaphthalene-2-carboxylic acid	present	LOTUS
(5R,8S)-4-hydroxy-5-(hydroxymethyl)-8-[(2S)-6-methylhept-5-en-2-yl]-5,6,7,8-tetrahydronaphthalene-2-carboxylic acid	present	LOTUS
Verbascoside	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila glabra has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMT650343.1 ↗151 496 bpAustralia

ACGT

TGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTATATTATTTA …

Eremophila glabra voucher MELUD119300a plastid, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL10

plant barcode

06Genome at a glanceGoaT

The complete instruction manual Eremophila glabra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 039 records

Wild obs. + sensor4 480

Museum / vouchered543

Cultivated / captive2

Other14

Origin

Native859

Introduced1

Range

Area of Occupancy AOO11 588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 3 062≤1 km 747≤10 km 256>10 km 105

4 170 georeferenced · 310 without coordinates

Open the mapobservation + sensor4 480

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 171≤1 km 73≤10 km 165>10 km 31

440 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence543

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	147
Museo Entomologico de Leonlocation not on record	83
Adelaide, AU	55
Mount Annan, AU	43
Canberra, AU	29
NSW Dept of Planning, Industry and Environmentlocation not on record	20
Palmerston, AU	19
Armidale, AU	19
Hobart, AU	14
Kew, GB	8
Parkville, AU	8
Brisbane, AU	6
Stockholm, SE	5
BGPAlocation not on record	5
John T. Waterhouse Herbariumlocation not on record	4
EL PASO, US	4
La Trobe Universitylocation not on record	2
Joondalup, AU	2
University of Stellenboschlocation not on record	2
Canadian Department of Agriculturelocation not on record	2
MeiseBGlocation not on record	2
LDlocation not on record	2
IPA/SPlocation not on record	1
Taipei, TW	1
Auckland, NZ	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Saint Louis, US	1
Beijing, CN	1
DOI/NPS, Greenbelt Parklocation not on record	1
Riverside, US	1
Wellington, NZ	1
Bronx, US	1
Moscow State Universitylocation not on record	1

33 institutions · 492 of 543 vouchered records shown · 51 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila glabra

At a glance

Sources8 archives

Size & morphology19

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry7

Compound class profile2 classes

Documented compounds3 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 039 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 33 geolocated

Cultivated / Captivenot free-living

Record type5 039 records