Eremophila gilesii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records642

Data sources8

Biological traits40

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Eremophila gilesii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility642 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF642 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Eremophila gilesii, commonly known Charleville turkey bush, green turkey bush, desert fuchsia and Giles emu bush is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is usually a low, spreading shrub with pinkish-lilac to purple flowers and is widespread in the Northern Territory and all mainland states except Victoria. It is considered a difficult agricultural weed in some parts of Queensland but is often used as a bush medicine by Aboriginal people.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology19

Fruit length10.5 mm

Fruit width10.5 mm

Leaf length44.12 mm

Leaf length max60 mm

Leaf length min15 mm

Leaf mass22.8 mg

Leaf mass per area122 g/m2

Leaf size133 mm²

Leaf width3 mm

Leaf width max3 mm

Leaf width min1 mm

Plant height1 m

⚠ sources differ — AusTraits: 1 m · TRY: 1.5 m

Plant height max1.2 m

Plant height min0.1 m

Seed length2.75 mm

Seed mass0.954 mg

⚠ sources differ — TRY: 0.954 mg · AusTraits: 0.954 mg · GIFT: 102 mg

Seed mass max133 mg

Seed mass min80.05 mg

Seed width0.9 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeself

⚠ sources differ — AusTraits: barochory · GIFT: unspecialized

Flowering timennnyyyyyyyyn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Resprouting capacitypartial_resprouting

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear oblanceolate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Eremophila gilesii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cinnamic acids and derivatives $ Phenylethanoids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
[(2R,3S,4R,5S,6S)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-4-[(2R,3S,4S,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2-[[(2R,3S,4S,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate		present	LOTUS
Verbascoside		present	LOTUS

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila gilesii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411369.1 ↗6 677 bpAustralia

ACGT

TCGNGTGGGCTATCGTATCCAACCTGATTAGGTTGGGCTTTTCGTGCCTAGCGGGGCGTGCTTTGGCTTGTCTGCTGTCGTCTATTGCCT …

Eremophila gilesii subsp. gilesii isolate MJB2481 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Eremophila gilesii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type642 records

Wild obs. + sensor505

Museum / vouchered134

Cultivated / captive1

Other2

Origin

Native42

Range

Area of Occupancy AOO1 944 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 349≤1 km 25≤10 km 46>10 km 18

438 georeferenced · 67 without coordinates

Open the mapobservation + sensor505

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 35≤1 km 15≤10 km 41>10 km 6

97 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence134

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	32
Kensington, AU	20
Palmerston, AU	14
Adelaide, AU	12
Kew, GB	10
Canberra, AU	9
Armidale, AU	8
Hobart, AU	6
Museo Entomologico de Leonlocation not on record	5
John T. Waterhouse Herbariumlocation not on record	5
Brisbane, AU	3
Parkville, AU	2
Wellington, NZ	1
MeiseBGlocation not on record	1
Christchurch, NZ	1
STUlocation not on record	1
BGPAlocation not on record	1
Smithfield, AU	1

18 institutions · 132 of 134 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)