Eremophila gibsonii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records350

Data sources5

Biological traits22

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila gibsonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility350 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF350 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila gibsonii white form Eremophila gibsonii is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a sticky, glabrous, rounded shrub with narrow leaves and white to lilac-coloured flowers and which occurs in Western Australia, South Australia and the Northern Territory.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length32.75 mm

Leaf width1.5 mm

Plant height2.3 m

Plant height max2.1 m

Plant height min1.5 m

Seed length3 mm

Seed width0.8 mm

Life cycle & reproduction6

Dispersal typeanimal

Flowering timennnnnnnyyynn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila gibsonii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411509.1 ↗7 456 bpAustralia

ACGT

TATTAACCACTTTCCATATTTTTTTATAATATTAGTATTTTCGCAATATTTAATCACTAAATAAATTAAATAAATATTTTTCGGAGCAAA …

Eremophila gibsonii isolate RMF114 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type350 records

Wild obs. + sensor65

Museum / vouchered285

Origin

Native58

Range

Area of Occupancy AOO852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 41≤1 km 4≤10 km 6>10 km 4

55 georeferenced · 10 without coordinates

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 67≤1 km 73≤10 km 94>10 km 29

263 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence285

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	126
Palmerston, AU	44
Canberra, AU	31
Kensington, AU	21
Brisbane, AU	15
Museo Entomologico de Leonlocation not on record	15
Mount Annan, AU	7
Kew, GB	5
Wellington, NZ	1
EL PASO, US	1
Stockholm, SE	1
Armidale, AU	1
University of Stellenboschlocation not on record	1

13 institutions · 269 of 285 vouchered records shown · 16 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)