Eremophila georgei

Diels · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records422

Data sources7

Biological traits20

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Eremophila georgei's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility422 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF422 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Eremophila georgei is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a common, widespread shrub in central areas of the state, often growing on rocky ridges and hillsides and has serrated leaves and mauve, purple or pink flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length15.5 mm

Leaf width7.75 mm

Plant height2 m

Plant height max3 m

Plant height min0.6 m

Life cycle & reproduction6

Dispersal typeanimal

Flowering timennyyyyyyyyyy

Life formshrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Eremophila georgei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Prezizaane sesquiterpenoids2

Eremophilane sesquiterpenoids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,5R,7S,8S)-2,6,6,7-tetramethyltricyclo[6.2.1.01,5]undecan-7-ol	present	LOTUS
(1R,2R,5R,8S)-2,6,6,8-tetramethyltricyclo[6.2.1.01,5]undecan-7-one	present	LOTUS
(1R,2R,5R,8S)-2,6,6-trimethyl-7-methylidenetricyclo[6.2.1.01,5]undecane	present	LOTUS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila georgei has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411473.1 ↗7 507 bpAustralia

ACGT

TTAGAACATATTTACACATTTTTTACTAATTATTAGTATTTTCGCAATATTTAATCAATAAATTAATTAAATAAATATTTTTCGGATGAA …

Eremophila georgei isolate MJB2410 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Eremophila georgei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type422 records

Wild obs. + sensor202

Museum / vouchered220

Origin

Native10

Range

Area of Occupancy AOO1 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 189≤10 km 1>10 km 1

191 georeferenced · 11 without coordinates

Open the mapobservation + sensor202

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 39≤1 km 33≤10 km 100>10 km 21

193 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence220

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	106
Adelaide, AU	69
Canberra, AU	13
Mount Annan, AU	7
Museo Entomologico de Leonlocation not on record	6
Claremont, US	5
Palmerston, AU	5
BGPAlocation not on record	5
Brisbane, AU	3
Parkville, AU	1

10 institutions · 220 of 220 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)