Eremophila freelingii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records3 640

Data sources7

Biological traits36

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Eremophila freelingii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 640 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF3 640 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Eremophila freelingii, commonly known as limestone fuchsia or rock fuchsia bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a shrub with sticky, hairy, lance-shaped leaves and flowers a shade of light to dark lilac and which occurs in Queensland, New South Wales and South Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length7.5 mm

Fruit width3.75 mm

Leaf length57.5 mm

Leaf length max85 mm

Leaf length min30 mm

Leaf mass per area209 g/m2

Leaf width7.5 mm

Leaf width max12.5 mm

Leaf width min4 mm

Plant height1.75 m

Plant height max2 m

Seed length2 mm

Seed mass31.9 mg

⚠ sources differ — TRY: 31.9 mg · AusTraits: 28.98 mg · GIFT: 31.9 mg

Seed mass max31.9 mg

Seed mass min31.9 mg

Seed width0.7 mm

Life cycle & reproduction7

Dispersal typeanimal

Flowering timeyynnnyyyyyyy

Life formshrub

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition5 compounds

Compounds documented for Eremophila freelingii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Norsesterterpenoids2

Eremane diterpenoids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(2S)-2-[(E)-5-(furan-3-yl)-2-methylpent-2-enyl]-4-methyl-2H-furan-5-one	present	LOTUS
(5E)-5-[(E)-5-(furan-3-yl)-2-methylpent-2-en-4-ynylidene]-3-methylfuran-2-one	present	LOTUS
(5Z)-3-methyl-5-[[(1R,4S,7R,9R)-4,8,8-trimethyl-9-tricyclo[5.2.2.01,5]undec-5-enyl]methylidene]furan-2-one	present	LOTUS
2-[5-(furan-3-yl)-2-methylpent-2-enyl]-4-methyl-2H-furan-5-one	present	LOTUS
5-[5-(Furan-3-yl)-2-methylpent-2-en-4-ynylidene]-3-methylfuran-2-one	present	LOTUS

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila freelingii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411566.1 ↗6 718 bpAustralia

ACGT

TCGTGCGGCAGCTCGTGTTTTGATGCAGAAAGTTGCCAACCGGACCCTTCGTCGGAAGCGTGCTGTCGTATCCAACCTGGTCTAGGTTGT …

Eremophila freelingii isolate RMF248 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Eremophila freelingii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 640 records

Wild obs. + sensor2 442

Museum / vouchered1 188

Cultivated / captive1

Other9

Origin

Native1 124

Range

Area of Occupancy AOO8 816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 918≤1 km 132≤10 km 31>10 km 25

1 106 georeferenced · 1 336 without coordinates

Open the mapobservation + sensor2 442

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 142≤1 km 238≤10 km 564>10 km 197

1 141 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence1 188

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	615
Palmerston, AU	143
Canberra, AU	110
Brisbane, AU	93
Museo Entomologico de Leonlocation not on record	70
Mount Annan, AU	51
Armidale, AU	8
John T. Waterhouse Herbariumlocation not on record	7
Hobart, AU	5
Kew, GB	4
EL PASO, US	2
Kensington, AU	2
Parkville, AU	2
GB	2
MAlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
MeiseBGlocation not on record	1
La Trobe Universitylocation not on record	1

18 institutions · 1 118 of 1 188 vouchered records shown · 70 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila freelingii

At a glance

Sources7 archives

Size & morphology16

Life cycle & reproduction7

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

Compound class profile2 classes

Documented compounds5 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 640 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 18 geolocated

Cultivated / Captivenot free-living

Record type3 640 records