Eremophila forrestii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records354

Data sources7

Biological traits21

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Eremophila forrestii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility354 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF354 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila forrestii, commonly known as Wilcox bush is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a many-branched shrub with its branches, leaves and sepals densely-covered with a thick layer of greyish or yellowish hairs giving the plant a felty appearance. Its flowers are cream-coloured to pink and are spotted or streaked dark red. It occurs mostly in Western Australia but also in the far west of South Australia and the Northern Territory. Six subspecies are recognised by the Western Australian Government Department of Parks and Wildlife.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length22.5 mm

Leaf width8.25 mm

Plant height2 m

Plant height max2 m

Plant height min0.5 m

Life cycle & reproduction6

Dispersal typeanimal

Flowering timennnyyyyyyynn

Life formsubshrub or shrub

Life spanperennial

Pollination syndromebird

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Eremophila forrestii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cinnamic acids and derivatives $ Phenylethanoids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
[(2R,3S,4R,5S,6S)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-4-[(2R,3S,4S,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2-[[(2R,3S,4S,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate		present	LOTUS
Verbascoside		present	LOTUS

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila forrestii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN486170.1 ↗6 848 bpAustralia

ACGT

TGCGAGGGCAATCCTCGGTGCGGTGGGCTTGAGCTCAAAGCTAATGGATGTTCGAGCGTGCGTTACCCCAACCTGTGCGTATCCTCTCTA …

Eremophila forrestii subsp. viridis isolate RMF167 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type354 records

Wild obs. + sensor232

Museum / vouchered122

Origin

Native22

Range

Area of Occupancy AOO1 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 138≤1 km 8≤10 km 41>10 km 11

198 georeferenced · 34 without coordinates

Open the mapobservation + sensor232

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 23≤1 km 5≤10 km 36>10 km 26

90 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence122

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	48
Mount Annan, AU	22
Brisbane, AU	14
Kew, GB	7
Palmerston, AU	7
Adelaide, AU	6
BGPAlocation not on record	4
John T. Waterhouse Herbariumlocation not on record	3
Canberra, AU	3
Hobart, AU	2
Museo Entomologico de Leonlocation not on record	2
Parkville, AU	1
Claremont, US	1
JBRJlocation not on record	1
Armidale, AU	1

15 institutions · 122 of 122 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)