Eremophila foliosissima

Kraenzl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records153

Data sources5

Biological traits22

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila foliosissima's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility153 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF153 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila foliosissima, commonly known as poverty bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a small, erect, densely foliaged shrub with long, narrow, hairy leaves and mauve to purple flowers. It is similar to Eremophila gilesii but is more dense and rounded, has more crowded leaves and has different hairs on the flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length64 mm

Leaf width1.5 mm

Plant height0.5 m

Plant height max1.5 m

Plant height min0.3 m

Seed length3 mm

Seed width1 mm

Life cycle & reproduction6

Dispersal typeanimal

Flowering timennnnnnyyynnn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila foliosissima has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411472.1 ↗7 502 bpAustralia

ACGT

TTAGAATATATTTATCAATTTTTTACTAATTATTAGTATTTTCGCAATATTTAATTAATAAATTAATTAAATAAATATTTTTCGAATCAA …

Eremophila foliosissima isolate MJB2409 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type153 records

Wild obs. + sensor18

Museum / vouchered135

Origin

Native1

Range

Area of Occupancy AOO476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 11≤10 km 4

15 georeferenced · 3 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 15≤1 km 5≤10 km 79>10 km 14

113 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	88
Adelaide, AU	27
Canberra, AU	5
Parkville, AU	4
Museo Entomologico de Leonlocation not on record	3
John T. Waterhouse Herbariumlocation not on record	3
Claremont, US	2
Mount Annan, AU	1
Palmerston, AU	1
BGPAlocation not on record	1

10 institutions · 135 of 135 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)