Eremophila flaccida — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records4

Data sources6

Biological traits19

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eremophila flaccida's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF4 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila flaccida is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a low, spreading shrub with sticky, shiny foliage and large, attractive flowers. There are two subspecies, one common and relatively widespread, the other known from only a few locations.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length62.5 mm

Leaf width17 mm

Plant height1.25 m

Plant height max1.5 m

Plant height min0.5 m

Seed length2.7 mm

Seed width1 mm

Life cycle & reproduction3

Flowering timennnnyyyyynnn

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Eremophila flaccida across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavanones1

Elemane sesquiterpenoids1

Eudesmane sesquiterpenoids1

Documented compounds3 total

Compound	Amount	Source
(2S)-pinocembrin	present	LOTUS
alpha-Elemol	present	LOTUS
beta-Eudesmol	present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila flaccida has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411410.1 ↗7 507 bpAustralia

ACGT

TTCTAAAGACTTTCCATATTTTTCCTAATTATTAGTATTTTCGCAATATTTAATCAATAAATTAATTAAATAAATATTTTTCGGATCAAA …

Eremophila flaccida subsp. flaccida isolate RMF67 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL3ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence4

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	2
Kensington, AU	1
Kew, GB	1

3 institutions · 4 of 4 vouchered records shown