Eremophila falcata

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records93

Data sources5

Biological traits20

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila falcata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility93 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF93 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila falcata is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a widely distributed shrub with distinctive curved leaves and white, lilac-coloured or pink flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length25 mm

Leaf width3.75 mm

Plant height2 m

Plant height max3 m

Plant height min1 m

Life cycle & reproduction6

Dispersal typeanimal

Flowering timennnnnnnnnyyn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila falcata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411470.1 ↗7 398 bpAustralia

ACGT

TTCAAACCACTTTCCACATTTTTTTCTAATTACTAGTATTTTCGCAATATTTAATCAATAAATAAATTAAATAAATATTTTTGGAGCAAA …

Eremophila falcata isolate MJB2428 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type93 records

Wild obs. + sensor16

Museum / vouchered77

Origin

Native4

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 15≤1 km 1

16 georeferenced

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 19≤1 km 14≤10 km 28>10 km 3

64 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	31
Adelaide, AU	26
Canberra, AU	8
Museo Entomologico de Leonlocation not on record	3
Mount Annan, AU	2
Parkville, AU	2
Palmerston, AU	2
Brisbane, AU	1
John T. Waterhouse Herbariumlocation not on record	1
BGPAlocation not on record	1

10 institutions · 77 of 77 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)