Eremophila exilifolia

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records382

Data sources8

Biological traits22

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Eremophila exilifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility382 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF382 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila exilifolia is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a widely distributed shrub which is shaped like an inverted cone and has small, very sticky leaves and branches and lilac-coloured flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length7.25 mm

Leaf width1.05 mm

Plant height1 m

Plant height max2 m

Plant height min0.3 m

Seed length2.5 mm

Seed width1 mm

Life cycle & reproduction6

Dispersal typeanimal

Flowering timennnyyyyyyynn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Eremophila exilifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Phytane diterpenoids3

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(E,Z,E,Z)-2-(9-Hydroxy-4,8-dimethyl-3,7-nonadienyl)-6-methyl-2,6-octadienedioic acid	present	LOTUS
(E,Z,Z,Z)-2-(9-Hydroxy-4,8-dimethyl-3,7-nonadienyl)-6-methyl-2,6-octadienedioic acid	present	LOTUS
2-(9-Hydroxy-4,8-dimethylnona-3,7-dienyl)-6-methylocta-2,6-dienedioic acid	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila exilifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411469.1 ↗7 463 bpAustralia

ACGT

TTCTACTTACTTTCCACATTTTTTCCTAATTATTAGTATTTTCGCAATATTTATTCATTAAATTAATTAAATAAATATTTTTCAGATTAG …

Eremophila exilifolia isolate MJB2406 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila exilifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type382 records

Wild obs. + sensor77

Museum / vouchered305

Origin

Native18

Range

Area of Occupancy AOO1 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 43≤1 km 6≤10 km 5>10 km 6

60 georeferenced · 17 without coordinates

Open the mapobservation + sensor77

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 65≤1 km 43≤10 km 131>10 km 15

254 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence305

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	157
Adelaide, AU	66
Canberra, AU	20
Mount Annan, AU	15
Palmerston, AU	15
Museo Entomologico de Leonlocation not on record	12
Kew, GB	6
BGPAlocation not on record	5
John T. Waterhouse Herbariumlocation not on record	3
Brisbane, AU	2
Parkville, AU	2
Claremont, US	1
Smithfield, AU	1

13 institutions · 305 of 305 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)