Eremophila duttonii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records1 864

Data sources8

Biological traits39

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Eremophila duttonii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 864 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF1 864 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila duttonii, commonly known as budda or harlequin fuchsia bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to mainland Australia where it occurs in all the mainland states except Victoria. It is a shrub or small tree with dark green, sticky leaves and flowers that are red on top fading to yellow-green below. Extracts from this plant have been shown to have significant antimicrobial activity.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology18

Fruit length9.25 mm

Fruit width6 mm

Leaf length36.51 mm

Leaf length max50 mm

Leaf length min15 mm

Leaf mass22.33 mg

Leaf mass per area148 g/m2

Leaf size102 mm²

Leaf width4.6 mm

Leaf width max8 mm

Leaf width min2.5 mm

Plant height3.5 m

⚠ sources differ — AusTraits: 3.5 m · TRY: 2.7 m

Plant height max3.5 m

Seed length4 mm

Seed mass2.44 mg

⚠ sources differ — TRY: 2.44 mg · AusTraits: 2.44 mg · GIFT: 42.33 mg

Seed mass max45.23 mg

Seed mass min39.43 mg

Seed width1.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeself

⚠ sources differ — AusTraits: barochory · GIFT: unspecialized

Flowering timennnnnnnyyyyy

Life formshrub

Life spanperennial > 20 years

⚠ sources differ — TRY: perennial > 20 years · AusTraits: perennial · GIFT: perennial

Pollination syndromebird

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.65 mm²/mg

03Chemical composition3 compounds

Compounds documented for Eremophila duttonii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Serrulatane and Biflorane diterpenoids3

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(5R,8S)-5-Methyl-8-(6-methylhept-5-en-2-yl)-5,6,7,8-tetrahydronaphthalene-2-carboxylic acid	present	LOTUS
(5S,6R,8R)-8-(hydroxymethyl)-3-methyl-5-[(2S)-6-methylhept-5-en-2-yl]-5,6,7,8-tetrahydronaphthalene-1,2,6-triol	present	LOTUS
(5S,8R)-8-(hydroxymethyl)-3-methyl-5-[(2S)-6-methylhept-5-en-2-yl]-5,6,7,8-tetrahydronaphthalene-1,2-diol	present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila duttonii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411502.1 ↗6 988 bpAustralia

ACGT

CCGTTTGGCCTGTTCCGGCAAGAAATAAGCAAGCCAATCCGATGGGTATTGGCCTCTAACGGTGTGTTGTGTTGCAAGTGCCCCCAGGGG …

Eremophila duttonii isolate MJB2483 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila duttonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 864 records

Wild obs. + sensor840

Museum / vouchered1 018

Other6

Origin

Native394

Range

Area of Occupancy AOO5 588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 484≤1 km 36≤10 km 54>10 km 11

585 georeferenced · 255 without coordinates

Open the mapobservation + sensor840

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 140≤1 km 172≤10 km 457>10 km 202

971 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence1 018

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	451
Canberra, AU	132
Palmerston, AU	109
Brisbane, AU	107
Mount Annan, AU	68
Museo Entomologico de Leonlocation not on record	67
Kensington, AU	13
Armidale, AU	13
Hobart, AU	8
Kew, GB	7
John T. Waterhouse Herbariumlocation not on record	7
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Parkville, AU	3
MAlocation not on record	1
Wellington, NZ	1
Christchurch, NZ	1

16 institutions · 991 of 1 018 vouchered records shown · 27 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila duttonii

At a glance

Sources8 archives

Size & morphology18

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry3

Compound class profile1 class

Documented compounds3 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 864 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Record type1 864 records