Eremophila drummondii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records527

Data sources6

Biological traits21

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eremophila drummondii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility527 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF527 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila drummondii, commonly known as Drummond's eremophila, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to the south-west of Western Australia. It is a variable shrub, usually with sticky branches and leaves, long, thin leaves and mauve or purple flowers in spring.Eremophila drummondii flower detail Eremophila drummondii habit near Wyalkatchem

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length27.5 mm

Leaf width3.35 mm

Plant height2 m

Plant height max2 m

Plant height min0.3 m

Seed length1.4 mm

Seed width0.65 mm

Life cycle & reproduction4

Flowering timennnyyyyyyyyn

Life formsubshrub or shrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Eremophila drummondii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cinnamic acids and derivatives $ Phenylethanoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Verbascoside		present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila drummondii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411427.1 ↗7 501 bpAustralia

ACGT

TTCAGCCCACTTTCCACATTTTTTCTAATTATTAATATTTTCGCAATATTTTATCAATAAATAAATTAAATAAATATTTTTCGGAGCAAA …

Eremophila drummondii isolate RMF11 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type527 records

Wild obs. + sensor116

Museum / vouchered410

Cultivated / captive1

Origin

Native21

Introduced1

Range

Area of Occupancy AOO1 488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 85≤1 km 11≤10 km 6>10 km 1

103 georeferenced · 13 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 96≤1 km 50≤10 km 195>10 km 24

365 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence410

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	220
Adelaide, AU	74
Canberra, AU	34
Museo Entomologico de Leonlocation not on record	33
Mount Annan, AU	24
Brisbane, AU	7
Hobart, AU	5
Kew, GB	3
Joondalup, AU	2
BGPAlocation not on record	2
Palmerston, AU	2
MAlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
Parkville, AU	1
LDlocation not on record	1

15 institutions · 410 of 410 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)