Eremophila divaricata

(F.Muell.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records210

Data sources8

Biological traits32

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Eremophila divaricata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility210 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF210 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila divaricata, also known as spreading emu bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Australia. It is a shrub with stiff, spreading, tangled branches which are often spiny on their ends, erect leaves and mauve to lilac-coloured flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology14

Fruit length7 mm

Fruit width3.25 mm

Leaf length15 mm

Leaf length max34 mm

Leaf length min4.5 mm

Leaf mass per area382 g/m2

Leaf width4 mm

Leaf width max4 mm

Leaf width min1 mm

Plant height1.5 m

Plant height max1.5 m

Seed mass18.53 mg

Seed mass max18.52 mg

Seed mass min18.52 mg

Life cycle & reproduction7

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyyyyynnnyyyy

Life formshrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

⚠ sources differ — AusTraits: drupe · GIFT: nut

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear oblanceolate oblong

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila divaricata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411400.1 ↗7 387 bpAustralia

ACGT

TTAAACCCACTTTCCAATTTTGTTTCTAATTATTAATATTTTCGCAATATTTAATCAATAAATAAATTAAATAAATAGTTTTCGGAGAAA …

Eremophila divaricata subsp. divaricata isolate RMF227 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila divaricata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type210 records

Wild obs. + sensor178

Museum / vouchered31

Other1

Origin

Native7

Range

Area of Occupancy AOO636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 93≤1 km 16≤10 km 17>10 km 19

145 georeferenced · 33 without coordinates

Open the mapobservation + sensor178

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 3≤1 km 6≤10 km 8

17 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	9
Mount Annan, AU	7
Adelaide, AU	5
Museo Entomologico de Leonlocation not on record	4
Canberra, AU	2
Brisbane, AU	1
Kew, GB	1
Parkville, AU	1
Miami, US	1

9 institutions · 31 of 31 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)