Eremophila deserti

(A.Cunn. ex Benth.) Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records4 068

Data sources7

Biological traits42

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Eremophila deserti's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 068 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources42 traits

Chemical compositionLOTUS22 compounds

Occurrence & distributionGBIF4 068 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila deserti is a shrub which is endemic to Australia. Common names for this species include turkey bush, dogwood, poison bush Ellangowan poison bush, pencil bush and carrot bush. It is common and widespread in all mainland states, although not the Northern Territory. Some forms are poisonous to stock.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology17

Fruit length5.25 mm

Fruit width4.75 mm

Leaf length50 mm

Leaf length max55 mm

Leaf length min20 mm

Leaf mass29 mg

Leaf mass per area215 g/m2

Leaf size76 mm²

⚠ sources differ — TRY: 76 mm² · AusTraits: 114 mm²

Leaf width5 mm

Leaf width max8 mm

Leaf width min3 mm

Plant height4 m

⚠ sources differ — AusTraits: 4 m · TRY: 1.5 m

Plant height max4 m

Plant height min0.3 m

Seed length3.2 mm

Seed mass1.8 mg

⚠ sources differ — TRY: 1.8 mg · AusTraits: 27.08 mg

Seed width1 mm

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnnnyyyyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

⚠ sources differ — AusTraits: hermaphrodite · GIFT: dioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear oblanceolate

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry7

Leaf c466 mg/g

Leaf dry-matter content (LDMC)827 mg/g

Leaf n16.21 mg/g

Leaf p0.902 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)4.58 mm²/mg

03Chemical composition22 compounds

Compounds documented for Eremophila deserti across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Iridoids monoterpenoids5

Secoeudesmane sesquiterpenoids1

Branched fatty acids $ Unsaturated fatty acids1

Documented compounds22 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2R,5R)-2-methyl-5-[(2S)-1-oxopropan-2-yl]cyclopentane-1-carbaldehyde	present	LOTUS
(4aS,7R,7aR)-1-Methoxy-4,7-dimethyl-1,4a,5,6,7,7a-hexahydrocyclopenta(c)pyran	present	LOTUS
(4R)-1-(furan-3-yl)-4,8-dimethylnonane-1,6-dione	present	LOTUS
1-(Furan-3-yl)-4,8-dimethylnonane-1,6-dione	present	LOTUS
1-[(1R,2R,5S)-2-(furan-3-yl)-2-hydroxy-5-methylcyclopentyl]-3-methylbutan-1-one	present	LOTUS
1-[(1S,2R,5S)-2-(furan-3-yl)-2-hydroxy-5-methylcyclopentyl]-3-methylbut-2-en-1-one	present	LOTUS
1-[(1S,2R,5S)-2-(furan-3-yl)-2-hydroxy-5-methylcyclopentyl]-3-methylbutan-1-one	present	LOTUS
1-[(1S,2S,5S)-2-(furan-3-yl)-2-hydroxy-5-methylcyclopentyl]-3-methylbut-2-en-1-one	present	LOTUS
1-[(1S,5S)-2-(furan-3-yl)-5-methylcyclopent-2-en-1-yl]-3-methylbutan-1-one	present	LOTUS
1-[(2R,5R)-5-(furan-3-yl)-2-methyloxolan-2-yl]propan-2-one	present	LOTUS

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila deserti has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411558.1 ↗7 339 bpAustralia

ACGT

TCACCCCTTTCCAATTTTTTTTAATTATTAATATTTTCGCAATATTTAATAATAAATAAATTAAATAAATAATTTTGAGCAAAAATTATA …

Eremophila deserti isolate RMF228 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type4 068 records

Wild obs. + sensor2 305

Museum / vouchered1 534

Cultivated / captive7

Other222

Origin

Native675

Introduced1

Range

Area of Occupancy AOO11 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 648≤1 km 251≤10 km 231>10 km 41

2 171 georeferenced · 134 without coordinates

Open the mapobservation + sensor2 305

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 235≤1 km 296≤10 km 611>10 km 279

1 421 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence1 534

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy75% within 1 km

≤100 m 1≤1 km 2≤10 km 1

4 georeferenced · 3 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	399
Brisbane, AU	346
Museo Entomologico de Leonlocation not on record	191
Canberra, AU	188
Mount Annan, AU	156
Kensington, AU	81
Armidale, AU	39
NSW Dept of Planning, Industry and Environmentlocation not on record	25
John T. Waterhouse Herbariumlocation not on record	12
Kew, GB	8
Parkville, AU	8
Hobart, AU	3
Palmerston, AU	2
La Trobe Universitylocation not on record	2
EL PASO, US	2
Saint Louis, US	1
MeiseBGlocation not on record	1
BGPAlocation not on record	1
Stockholm, SE	1
Wellington, NZ	1
Claremont, US	1
James Cook Townsvillelocation not on record	1
Wollongong, AU	1

23 institutions · 1 470 of 1 534 vouchered records shown · 64 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila deserti

At a glance

Sources7 archives

Size & morphology17

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry7

Compound class profile3 classes

Documented compounds22 total

At a glance

Record type4 068 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 23 geolocated

Cultivated / Captivenot free-living

Record type4 068 records