Eremophila demissa

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records26

Data sources5

Biological traits18

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila demissa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF26 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila demissa is a flowering plant in the figwort family, Scrophulariaceae and is endemic to a small area of central Western Australia. It is a low, spreading shrub with small, yellowish grey leaves and branches and mauve to blue flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Leaf length9.25 mm

Leaf width3 mm

Plant height0.45 m

Plant height max0.5 m

Seed length3 mm

Seed width1 mm

Life cycle & reproduction3

Flowering timennynnnnnnnnn

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila demissa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN486196.1 ↗7 481 bpAustralia

ACGT

TTTTTTCTAATTTTAGTATTTTGCAATATTTTATTAATATATAAATTAAATAAATATTTTTTGAAAAAAATTATATTTTCGCATTATATT …

Eremophila demissa isolate RMF82 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor2

Museum / vouchered24

Origin

Native1

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 23

23 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	8
Kensington, AU	5
Parkville, AU	2
Museo Entomologico de Leonlocation not on record	2
Canberra, AU	2
BGPAlocation not on record	2
Mount Annan, AU	1
Kew, GB	1
Palmerston, AU	1

9 institutions · 24 of 24 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)