Eremophila decipiens

Ostenf. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records167

Data sources7

Biological traits23

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Eremophila decipiens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility167 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF167 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Eremophila decipiens, commonly known as slender fuchsia bush or narrow-leaved fuchsia bush (although it is not closely related to Fuchsia) is a flowering plant in the figwort family, Scrophulariaceae and is endemic to an area extending from the south-west of Western Australia to southern parts of South Australia. It is low, sprawling shrub with lance-shaped leaves and red, orange or yellow flowers on a long, S-shaped stalk.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology8

Fruit length6.5 mm

Fruit width6.5 mm

Leaf length30.5 mm

Leaf width5.65 mm

Plant height1 m

Plant height max1.8 m

Plant height min0.1 m

Seed mass64.2 mg

Life cycle & reproduction6

Dispersal typeanimal

Flowering timenyyyyyyyyyyy

Life formshrub

Life spanperennial

Pollination syndromebird

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Eremophila decipiens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cinnamic acids and derivatives $ Phenylethanoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Verbascoside		present	LOTUS

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila decipiens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411367.1 ↗7 518 bpAustralia

ACGT

TTCAACCCACTTTCCACATTTTTTCTAATTATTAATATTTTCACAATATTTTATCAATAAATAAATTAAATAAATATTTTTTGGAGCAAA …

Eremophila decipiens subsp. decipiens isolate RMF190 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Eremophila decipiens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type167 records

Wild obs. + sensor90

Museum / vouchered77

Origin

Native6

Range

Area of Occupancy AOO564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 53≤1 km 9≤10 km 9>10 km 3

74 georeferenced · 16 without coordinates

Open the mapobservation + sensor90

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 10≤1 km 16≤10 km 10>10 km 15

51 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	17
Adelaide, AU	13
Kensington, AU	11
Parkville, AU	9
Palmerston, AU	6
Kew, GB	5
Museo Entomologico de Leonlocation not on record	3
Mount Annan, AU	3
Canberra, AU	3
Joondalup, AU	2
MAlocation not on record	2
BGPAlocation not on record	2
Claremont, US	1

13 institutions · 77 of 77 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)