Eremophila debilis

(Andrews) Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records6 588

Data sources6

Biological traits41

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eremophila debilis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 588 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF6 588 records

DNA & barcodingNCBIsequences

01Narrative

Growth habit Fruit Eremophila debilis, the winter apple or amulla, is a flowering plant in the figwort family Scrophulariaceae, and is endemic to an area extending from north Queensland to near the border between New South Wales and Victoria in Australia. It is a prostrate shrub with elliptic to lance-shaped or egg-shaped leaves and white, rarely deep mauve flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology16

Fruit length8.5 mm

⚠ sources differ — AusTraits: 8.5 mm · GIFT: 9 mm

Fruit width8 mm

⚠ sources differ — AusTraits: 8 mm · GIFT: 10 mm

Leaf length58.5 mm

Leaf length max125 mm

Leaf length min20 mm

Leaf mass per area70.36 g/m2

Leaf size931 mm²

Leaf width14 mm

⚠ sources differ — AusTraits: 14 mm · GIFT: 7 mm

Leaf width max20 mm

Leaf width min3.5 mm

Plant height1 m

⚠ sources differ — GIFT: 1 m · AusTraits: 2 m

Seed length3.25 mm

Seed mass4.41 mg

⚠ sources differ — TRY: 4.41 mg · AusTraits: 54.03 mg · GIFT: 26.6 mg

Seed mass max48.83 mg

Seed mass min4.37 mg

Seed width1.05 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formsubshrub

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Self fertilizationpresent

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Habitat GIFTCoastal

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)14.53 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila debilis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411584.1 ↗7 536 bpAustralia

ACGT

TTCACGCCCTTTTCTATATTTTTTCATAATTATTGATATTTTCGTAATATTTAATTAATAAATAAATTAAGTAAATTATTTTCCGTGCAA …

Eremophila debilis isolate RMF290 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type6 588 records

Wild obs. + sensor5 670

Museum / vouchered545

Cultivated / captive4

Other369

Origin

Native115

Introduced1

Range

Area of Occupancy AOO13 740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 4 907≤1 km 268≤10 km 86>10 km 153

5 414 georeferenced · 256 without coordinates

Open the mapobservation + sensor5 670

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 170≤1 km 70≤10 km 184>10 km 65

489 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence545

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	214
Mount Annan, AU	114
Canberra, AU	65
Museo Entomologico de Leonlocation not on record	45
Adelaide, AU	25
Armidale, AU	25
NSW Dept of Planning, Industry and Environmentlocation not on record	21
John T. Waterhouse Herbariumlocation not on record	8
Wollongong, AU	6
Smithfield, AU	4
Auckland, NZ	3
Parkville, AU	2
Palmerston, AU	2
Kensington, AU	1
Northridge, US	1
Kew, GB	1
Christchurch, NZ	1

17 institutions · 538 of 545 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila debilis

At a glance

Sources6 archives

Size & morphology16

Life cycle & reproduction9

Diet & foraging1

Habitat & environment11

Physiology & chemistry3

Other traits1

At a glance

Record type6 588 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 17 geolocated

Cultivated / Captivenot free-living

Record type6 588 records