Eremophila cuneifolia

Kraenzl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records365

Data sources7

Biological traits22

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Eremophila cuneifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility365 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF365 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Eremophila cuneifolia, commonly known as pinyuru, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to the north-west of Western Australia. It is a spreading, sticky shrub with wedge-shaped leaves, coloured sepals and usually deep purple flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Leaf length10.5 mm

Leaf width8.75 mm

Plant height1.5 m

Plant height max1.8 m

Plant height min0.5 m

Seed mass67.77 mg

Life cycle & reproduction6

Dispersal typeanimal

Flowering timennnnnyyyyynn

Life formsubshrub or shrub

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Eremophila cuneifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Aromadendrane sesquiterpenoids1

Eudesmane sesquiterpenoids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
beta-Eudesmol		present	LOTUS
Spathulenol		present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila cuneifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

The DNA barcodea real sequence read deposited for this species

ITSOR742838.1 ↗7 502 bp

ACGT

CTAATTATTAGTATTTTCGCAATATTTAATAATAAATTAATTAAATAAATATTTTTGGATCAAAAATTATATTTTCACATTATATTATAA …

Eremophila cuneifolia isolate BMR07490 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★ITS5

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Eremophila cuneifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type365 records

Wild obs. + sensor80

Museum / vouchered285

Origin

Native10

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 28≤1 km 1≤10 km 8>10 km 10

47 georeferenced · 33 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 61≤1 km 36≤10 km 131>10 km 23

251 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence285

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	133
Adelaide, AU	66
Canberra, AU	27
Museo Entomologico de Leonlocation not on record	20
Palmerston, AU	9
John T. Waterhouse Herbariumlocation not on record	7
BGPAlocation not on record	7
Mount Annan, AU	4
Parkville, AU	4
Brisbane, AU	3
Kew, GB	3
Hobart, AU	1
JBRJlocation not on record	1

13 institutions · 285 of 285 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)