Eremophila christophori

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records372

Data sources5

Biological traits13

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila christophori's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility372 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources13 traits

Occurrence & distributionGBIF372 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila christophori, commonly known as dolomite fuchsia bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to the southern part of the Northern Territory in Australia. It is an erect shrub with bright green leaves and white, pink or lilac flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsWCVP

Size & morphology5

Fruit length6.25 mm

Fruit width2.75 mm

Leaf length17.75 mm

Leaf width4.5 mm

Plant height2.75 m

Life cycle & reproduction3

Life spanperennial

Resprouting capacityresprouts

Sex typehermaphrodite

Habitat & environment5

Climatedesert or dry shrubland

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila christophori has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN486163.1 ↗7 287 bpAustralia

ACGT

TTCAACCCACTTTCCACAATTTTTTCTTTTTTTNATTATTTTTGCAATAATTAATAAATAAATTAATTAAATAAATATTTTTGGGCAAAA …

Eremophila christophori isolate RMF08 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type372 records

Wild obs. + sensor149

Museum / vouchered223

Origin

Native9

Range

Area of Occupancy AOO976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 49≤1 km 4≤10 km 2>10 km 2

57 georeferenced · 92 without coordinates

Open the mapobservation + sensor149

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 21≤1 km 25≤10 km 129>10 km 38

213 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence223

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	72
Adelaide, AU	58
Canberra, AU	31
Museo Entomologico de Leonlocation not on record	25
Brisbane, AU	24
Mount Annan, AU	2
Lubbock, US	1
Taipei, TW	1
Hobart, AU	1
John T. Waterhouse Herbariumlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Canadian Department of Agriculturelocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
Christchurch, NZ	1
Armidale, AU	1
STUlocation not on record	1

16 institutions · 222 of 223 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)