Eremophila capricornica — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records21

Data sources4

Biological traits5

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Eremophila capricornica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility21 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF21 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila capricornica is a flowering plant in the figwort family, Scrophulariaceae and is endemic to Western Australia. It is a small shrub with woolly branches, grey, hairy leaves and mauve to lilac-coloured flowers with hairy sepals.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraits

Life cycle & reproduction2

Life spanperennial

Sex typehermaphrodite

Habitat & environment3

Climatedesert or dry shrubland

Growth formshrub

Woodinesswoody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila capricornica has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOP169586.1 ↗151 476 bpAustralia

ACGT

GGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTAATATTATTTT …

Eremophila capricornica isolate BMR01817 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL10

plant barcode

08Occurrence & distribution

Record type21 records

Wild obs. + sensor2

Museum / vouchered19

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 19

19 georeferenced

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	17
Parkville, AU	2

2 institutions · 19 of 19 vouchered records shown