Eremophila caespitosa

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records59

Data sources5

Biological traits20

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila caespitosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility59 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF59 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila caespitosa, commonly known as felty-leaved eremophila, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to an area near the centre of Western Australia. It is a small shrub with a tuft-like habit, very hairy grey leaves and lilac to purple flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology8

Leaf length10 mm

Leaf width1.3 mm

Plant height0.2 m

Plant height max0.3 m

Plant height min0.1 m

Seed length2.5 mm

Seed mass33.61 mg

Seed width0.8 mm

Life cycle & reproduction3

Flowering timennnnnnnyyynn

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila caespitosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411328.1 ↗7 476 bpAustralia

ACGT

TTCCACATTTTTTTNCTAATTATTAATGTTTTCGCAATATTTAATTAATATATAAATTAAATAAATATTTTTCGGAGCAAAAATTATATT …

Eremophila caespitosa isolate RMF68 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type59 records

Wild obs. + sensor1

Museum / vouchered58

Origin

Native2

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 16≤1 km 6≤10 km 16>10 km 4

42 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	25
Adelaide, AU	13
Canberra, AU	5
BGPAlocation not on record	4
Kew, GB	3
Museo Entomologico de Leonlocation not on record	3
Parkville, AU	2
Mount Annan, AU	2
University of Stellenboschlocation not on record	1

9 institutions · 58 of 58 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)