Eremophila caerulea

(S.Moore) Diels · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records60

Data sources5

Biological traits17

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila caerulea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility60 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF60 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila caerulea, commonly known as spotted eremophila, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to the south-west of Western Australia. It is a low, compact, spreading shrub with narrow, warty, cylindrical leaves and blue to purple flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length7 mm

Leaf width1.1 mm

Plant height0.75 m

Plant height max0.9 m

Plant height min0.2 m

Life cycle & reproduction3

Flowering timennnnnnnnyyyy

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila caerulea has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411379.1 ↗7 498 bpAustralia

ACGT

TTCAACCCACTTTCCACATTTTTTTCTAATTATTACTATTTTCGCAATATTTAATCAATAAATAAATTAAATAAATATTTTTAGAGCAAA …

Eremophila caerulea subsp. merrallii isolate RMF132 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type60 records

Wild obs. + sensor4

Museum / vouchered56

Origin

Native6

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3>10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 7≤1 km 7≤10 km 26>10 km 5

45 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	25
Adelaide, AU	9
Mount Annan, AU	6
Museo Entomologico de Leonlocation not on record	4
Brisbane, AU	3
Canberra, AU	3
BGPAlocation not on record	3
Kew, GB	2
Parkville, AU	1

9 institutions · 56 of 56 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)