Eremophila biserrata

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records42

Data sources5

Biological traits17

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila biserrata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF42 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila biserrata, also known as prostrate eremophila, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to a small area in the south of Western Australia. It is a prostrate shrub covering an area of up to about 2 m2 and which has serrated leaves and flowers that are green and yellow.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsWCVPGIFTTRY

Size & morphology5

Leaf length21 mm

Leaf width8 mm

Plant height1 m

Seed length2.5 mm

Seed width1 mm

Life cycle & reproduction3

Flowering timeyyynnnnnyyyy

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila biserrata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411542.1 ↗7 121 bpAustralia

ACGT

GGTTTCCGGTGGCCGGCGGGCACCCCCTGGACCGGCGACTTTCCGGAGGCCCGTCGCCCCGGCGATGCGGGCGTGTTGTGCTTCGTGCAC …

Eremophila biserrata isolate RMF188 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type42 records

Wild obs. + sensor4

Museum / vouchered37

Cultivated / captive1

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 1>10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 1≤10 km 35

36 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence37

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	19
Adelaide, AU	10
Canberra, AU	4
Parkville, AU	2
Kew, GB	1

5 institutions · 36 of 37 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)