Eremophila barbata

Chinnock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records30

Data sources5

Biological traits13

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila barbata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF30 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila barbata is a flowering plant in the figwort family, Scrophulariaceae and is endemic to a small area in the Eyre Peninsula of South Australia. It is a very rare, small, spreading shrub distinguished by a prominent "beard" on the lower lobe of its lilac-coloured flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsWCVPTRY

Size & morphology3

Leaf length7.5 mm

Leaf width5.25 mm

Plant height1 m

Life cycle & reproduction4

Dispersal typeanimal

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Habitat & environment5

Climatedesert or dry shrubland

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila barbata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN486161.1 ↗7 709 bpAustralia

ACGT

TTCACACCACTTCCATCGGTTTTTCATAATTATTAATACTTTTCATATTTTTTCATAAATATTAATATTTTTGCAATATTTAATTAATAA …

Eremophila barbata isolate PH01 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor8

Museum / vouchered22

Origin

Native8

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 6

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 10≤10 km 3>10 km 3

18 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	11
Museo Entomologico de Leonlocation not on record	2
Mount Annan, AU	2
Canberra, AU	2
Kensington, AU	1
Kew, GB	1
Saint Louis, US	1
Wlocation not on record	1
Palmerston, AU	1

9 institutions · 22 of 22 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)