Eremophila attenuata — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records4

Data sources5

Biological traits19

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Eremophila attenuata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Occurrence & distributionGBIF4 records

DNA & barcodingNCBIsequences

01Narrative

Eremophila attenuata, also known as Connie Sue poverty bush, is a flowering plant in the figwort family, Scrophulariaceae and is endemic to a small area in the south-east of Western Australia. It is a shrub with many branches often ending in a spine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length11.75 mm

Leaf width1.25 mm

Plant height0.9 m

Plant height max0.9 m

Plant height min0.6 m

Life cycle & reproduction5

Dispersal typeanimal

Flowering timennnnnnnnnnyn

Life spanperennial

Pollination syndromebird

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila attenuata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN486159.1 ↗6 967 bpAustralia

ACGT

GTAAGACTTCATGATCGCCGTTTGGCACTTCTGGCTAGAAATAGCGACCATCGGGGGGCATTGGCCTCCAGCGGTGTGTTGTGTTGCTAG …

Eremophila attenuata isolate RMF137 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced

Open the institutions mapphysical evidence4

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	3
Parkville, AU	1

2 institutions · 4 of 4 vouchered records shown