Eremophila alternifolia

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Eremophila

At a glance

Occurrence records2 469

Data sources9

Biological traits29

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Eremophila alternifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 469 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF2 469 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Eremophila alternifolia, commonly known as narrow-leaved poverty bush, is a plant in the figwort family, Scrophulariaceae, and is endemic to areas between the far west of New South Wales, the far south of the Northern Territory and the southern half of Western Australia. It is a variable shrub, with respect to its growth form, leaf shape and flower colour. Aboriginal Australians used the leaves to treat ailments such as colds and skin infections and pharmacological testing has shown that the leaves contain compounds that affect cardiac activity.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsWCVPGIFTTRY

Size & morphology11

Fruit length6 mm

Fruit width3.5 mm

Leaf length30 mm

Leaf length max55 mm

Leaf length min20 mm

Leaf width3 mm

Plant height3 m

Plant height max4 m

Plant height min1 m

Seed length3 mm

Seed width0.9 mm

Life cycle & reproduction6

Dispersal typeanimal

Flowering timeyynnnnnyyyyy

Life spanperennial

Pollination syndromebird

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition1 compounds

Compounds documented for Eremophila alternifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
3-Methylgalangin		present	LOTUS

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremophila alternifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN411333.1 ↗6 779 bpAustralia

ACGT

TGATTGCCGACGTGCATGGCAAGGTTTACCGTATGCCACGGCATCTCGTTGCGGCGAGCTCGTGTTTTGATGCTAGAAAGTTGCCATCCG …

Eremophila alternifolia isolate RMF202 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremophila alternifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BARLOW, B.A. 1971. Cytogeography of the genus Eremophila. Austral. J. Bot. 19: 295-310.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 469 records

Wild obs. + sensor938

Museum / vouchered1 530

Other1

Origin

Native790

Range

Area of Occupancy AOO6 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 382≤1 km 105≤10 km 90>10 km 19

596 georeferenced · 342 without coordinates

Open the mapobservation + sensor938

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 191≤1 km 361≤10 km 643>10 km 215

1 410 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence1 530

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	751
Kensington, AU	205
Canberra, AU	144
Museo Entomologico de Leonlocation not on record	135
Mount Annan, AU	69
Palmerston, AU	44
Brisbane, AU	32
Armidale, AU	13
Kew, GB	10
Hobart, AU	8
John T. Waterhouse Herbariumlocation not on record	7
Parkville, AU	6
Claremont, US	5
BGPAlocation not on record	3
MAlocation not on record	3
EL PASO, US	2
Beijing, CN	1
JBRJlocation not on record	1
MeiseBGlocation not on record	1
Smithfield, AU	1
Wellington, NZ	1
Christchurch, NZ	1
Riverside, US	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Córdoba, AR	1

25 institutions · 1 446 of 1 530 vouchered records shown · 84 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremophila alternifolia

At a glance

Sources9 archives

Size & morphology11

Life cycle & reproduction6

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 469 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 25 geolocated

Record type2 469 records