Eremogone fendleri

(A.Gray) Ikonn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Eremogone

At a glance

Occurrence records1 743

Data sources11

Biological traits24

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Eremogone fendleri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 743 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF1 743 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Eremogone fendleri, or Fendler's sandwort, is a perennial plant in the family Caryophyllaceae found in the Colorado Plateau and Canyonlands region of the southwestern United States.Canyon Country Wildflowers, Damian Fagan, 2nd ed., 2012, Morris Bush Publishing, LLC. in cooperation with Canyonlands Natural History Association,

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology5

Leaf size36.72 mm²

Plant height0.06 m

Seed mass0.72 mg

Seed mass max0.8 mg

Seed mass min0.63 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life formsubshrub

Life spanperennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry8

Leaf C:N ratio23.67 g/g

Leaf c431 mg/g

Leaf dry-matter content (LDMC)357 mg/g

Leaf n18.23 mg/g

Leaf p1.32 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)14.27 mm²/mg

Wood density301 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremogone fendleri has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP148915.1 ↗563 bpUSA

ACGT

AACGAAACATGTTATCAATCATGGCTGGGGCGGTGCTTGGTGCCTTGTGTGCCATATCCCCTCACATCCAAGCCCGGGGGGCACTCACTT …

Eremogone fendleri voucher M s.n. internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eremogone fendleri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records40–442n range44median44mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 443×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1988. Chromosome number reports XCIX. Taxon 37: 397–398.

CCDB · book-ipcn67-71 — HARTMAN, R.L. 1971. Chromosome numbers in Caryophyllaceae from Wyoming and adjacent states. Bull. Torrey Bot. Club 98: 276-280.

CCDB · eflora

2n 402×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — LOEVE, A.' & B. M. KAPOOR. 1967. In IOPB chromosome number reports XIV. Taxon 16: 552-571.

CCDB · book-ipcn67-71 — LOEVE, A, D. LOEVE, & B.M. KAPOOR. 1971. Cytotaxonomy of a century of Rocky Mountain orophytes. Arctic & Alpine Res. 3: 139-165.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 743 records

Wild obs. + sensor889

Museum / vouchered854

Range

Area of Occupancy AOO4 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 452≤1 km 80≤10 km 55>10 km 32

619 georeferenced · 270 without coordinates

Open the mapobservation + sensor889

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 80≤1 km 260≤10 km 123>10 km 6

469 georeferenced · 385 without coordinates

Open the institutions mapphysical evidence854

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	162
Denver, US	104
Musee des Dinosaures d'Esperaza (Aude)location not on record	95
Flagstaff, US	92
Albuquerque, US	58
DOI/NPS, Greenbelt Parklocation not on record	57
ASUlocation not on record	55
Durango, US	45
Wuzhou, CN	43
Rocky Mountain Biological Laboratorylocation not on record	15
Phoenix, US	15
Emporia, US	13
Logan, US	10
Chadron, US	9
San Luis Obispo, US	8
Bloomington, US	8
Orem, US	6
Riverside, US	6
USFSlocation not on record	4
Corvallis, US	4
Tempe, US	4
Pullman, US	4
Bronx, US	4
AUAlocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Provo, US	3
CASlocation not on record	3
Canadian Department of Agriculturelocation not on record	2
Dekalb, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Austin, US	1
Grand Junction, US	1
Fort Worth, US	1
Pittsburg, US	1
Saint Louis, US	1
Ann Arbor, US	1
Chicago, US	1
Millersville, US	1
US	1

39 institutions · 848 of 854 vouchered records shown · 6 without an institution code

09Environmental DNA2 detections

Where the DNA of Eremogone fendleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eremogone fendleri

At a glance

Sources11 archives

Size & morphology5

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry8

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 743 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions28 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 743 records