Eremogone congesta

(Nutt. ex Torr. & A.Gray) Ikonn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Eremogone

At a glance

Occurrence records954

Data sources11

Biological traits17

DNA specimens19

eDNA detections9

Sources11 archives

Databases and archives Eremogone congesta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility954 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF954 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Eremogone congesta is a species of flowering plant in the family Caryophyllaceae known by the common name ballhead sandwort. It is native to western North America from central Canada to the American southwest.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.086 m

Seed mass0.7 mg

⚠ sources differ — TRY: 0.7 mg · GIFT: 1.82 mg

Seed mass max3.45 mg

Seed mass min0.64 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

Physiology & chemistry4

Leaf c429 mg/g

Leaf dry-matter content (LDMC)259 mg/g

Leaf n28.96 mg/g

Photosynthetic pathwayC3

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremogone congesta has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes7

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG235374.1 ↗348 bpCanada · 1978

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAACCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Eremogone congesta voucher CCDB-24803-B06 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★trnL-F★ITS5★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Eremogone congesta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 · CCDB · eflora

CCDB · book-ipcn67-71 — HARTMAN, R.L. 1971. Chromosome numbers in Caryophyllaceae from Wyoming and adjacent states. Bull. Torrey Bot. Club 98: 276-280.

CCDB · book-ipcn73-74 — FINDLAY, J.N., & J. MCNEILL. 1973. In IOPB chromosome number reports XL. Taxon 22: 285-291.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type954 records

Wild obs. + sensor522

Museum / vouchered432

Range

Area of Occupancy AOO2 668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 308≤1 km 50≤10 km 20>10 km 20

398 georeferenced · 124 without coordinates

Open the mapobservation + sensor522

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 51≤1 km 133≤10 km 42>10 km 4

230 georeferenced · 202 without coordinates

Open the institutions mapphysical evidence432

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 48 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	75
Musee des Dinosaures d'Esperaza (Aude)location not on record	55
Arcata, US	53
Rocky Mountain Biological Laboratorylocation not on record	36
Boise, US	27
CASlocation not on record	25
Logan, US	15
Pocatello, US	14
Flagstaff, US	12
Davis, US	12
Moscow, US	9
Claremont, US	7
Provo, US	7
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	7
US	5
San Luis Obispo, US	5
WTUlocation not on record	5
STNFlocation not on record	4
Riverside, US	4
Durango, US	4
Weber State Universitylocation not on record	3
Yellowstone National Park Herbariumlocation not on record	3
Chapel Hill, US	3
Santa Barbara, US	3
Bronx, US	2
Truckee, US	2
Denver, US	2
Northridge, US	2
Uniwersytet Jagiellońskilocation not on record	2
Bandelier National Monumentlocation not on record	2
Cheney, US	2
Corvallis, US	2
Henderson, US	1
Saint Louis, US	1
Missoula, US	1
Portland, US	1
Pullman, US	1
Wlocation not on record	1
KNFYlocation not on record	1
University of Alberta Museumslocation not on record	1
Spearfish, US	1
Eastern Nevada Landscape Coalitionlocation not on record	1
Moscow State Universitylocation not on record	1
San Jose, US	1
Tempe, US	1
KNFHClocation not on record	1
Beijing, CN	1
ASUlocation not on record	1

48 institutions · 425 of 432 vouchered records shown · 7 without an institution code

09Environmental DNA9 detections

Where the DNA of Eremogone congesta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

Idaho Fescue/Bearded Wheatgrass-Sticky Geran…dry hillsidemoister prairie at head of ravine. Abundant,…prairieTalus slope. Idaho-Fescue/Bearded Wheatgrass…Rocky on slope with Lupine, Geum, Eriogonum,…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 8.40–12.4

Seasonal swing summer↔winter25.3 °C

Max temp (day)19.7 °C 15.9–20.0

Min temp (night)5.00 °C 1.70–5.00

Precipitation73.5 mm/mo 63.0–81.3

Air humidity45.9 % 45.2–47.7

Moisture balance-76.9 mm/mo -77.6–-43.4

Vapour deficit788 Pa 595–797

Wind speed4.50 m/s 3.60–5.40

Cloud cover24.9 % 23.4–29.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)